MD11G1019300.v1.1

Belongs to the UDP-glycosyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0003448
Physical Location & Seq
Reverse (-)
1660602 .. 1660916
315 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1019300.v1.1.491

Sequence Viewer

Length: 315 bp
ATGGGAACTGAAATTATTCCCACTCATATGTTTCTTGTGTGTTTTCCAGGACAGGGACACATAAACCCTATGCTCAGATTAGGCAAACGCCTAGCTGCAAAAGGGATTTTGGTCAGCTTCTCCACCACTGAAAACTTTGGCAAAGAGATGAGAGCAGCCAACGGTGGCATCAATGATGAACCCACACCTGTCGGCGATGGTTTTATCAGGTTTGAGTTTTTTGACGATGGTCCTCCAGACCAGGACCCTAAACGCACGGACTTGGACTACTATATGCCACTGCTTGAACTTGTGGGCAAGGATTTGGTAACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UDPGT

Protein Analysis

105

Amino Acids

11.53

Weight (kDa)

4.82

Isoelectric Point (pI)

37.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_transf_N PF26168 12 - 60 8.4e-07 Glycosyltransferase, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 53
AgsI TTSAA 1 cut(s) 287
AjnI CCWGG 2 cut(s) 46, 240
AluBI AGCT 2 cut(s) 95, 117
AluI AGCT 2 cut(s) 95, 117
ApeKI GCWGC 2 cut(s) 95, 155
Asp700I GAANNNNTTC 1 cut(s) 15
AspS9I GGNCC 2 cut(s) 230, 244
AvaII GGWCC 2 cut(s) 230, 244
BbvI GCAGC 2 cut(s) 82, 167
BccI CCATC 2 cut(s) 191, 221
BciT130I CCWGG 2 cut(s) 48, 242
BfaI CTAG 2 cut(s) 92, 313
BisI GCNGC 2 cut(s) 96, 156
BlsI GCNGC 2 cut(s) 97, 157
Bme1390I CCNGG 2 cut(s) 48, 242
Bme18I GGWCC 2 cut(s) 230, 244
BmgT120I GGNCC 2 cut(s) 230, 244
BmiI GGNNCC 1 cut(s) 246
BmrFI CCNGG 2 cut(s) 48, 242
BmsI GCATC 1 cut(s) 177
BoxI GACNNNNGTC 1 cut(s) 228
BpmI CTGGAG 1 cut(s) 219
Bsc4I CCNNNNNNNGG 1 cut(s) 53
BseBI CCWGG 2 cut(s) 48, 242
BseLI CCNNNNNNNGG 1 cut(s) 53
BseMII CTCAG 1 cut(s) 88
BseXI GCAGC 2 cut(s) 82, 167
BslFI GGGAC 1 cut(s) 69
BslI CCNNNNNNNGG 1 cut(s) 53
BsmFI GGGAC 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 87
BspLI GGNNCC 1 cut(s) 246
Bst2UI CCWGG 2 cut(s) 48, 242
Bst4CI ACNGT 1 cut(s) 164
BstDEI CTNAG 1 cut(s) 74
BstEII GGTNACC 1 cut(s) 307
BstNI CCWGG 2 cut(s) 48, 242
BstPAI GACNNNNGTC 1 cut(s) 228
BstPI GGTNACC 1 cut(s) 307
BstSCI CCNGG 2 cut(s) 46, 240
BstV1I GCAGC 2 cut(s) 82, 167
BtgZI GCGATG 1 cut(s) 210
BtsI GCAGTG 1 cut(s) 278
BtsIMutI CAGTG 2 cut(s) 126, 278
Cfr13I GGNCC 2 cut(s) 230, 244
CviJI RGCY 3 cut(s) 95, 117, 158
CviKI_1 RGCY 3 cut(s) 95, 117, 158
DdeI CTNAG 1 cut(s) 74
Eco47I GGWCC 2 cut(s) 230, 244
Eco91I GGTNACC 1 cut(s) 307
EcoO109I RGGNCCY 1 cut(s) 244
EcoO65I GGTNACC 1 cut(s) 307
EcoRII CCWGG 2 cut(s) 46, 240
FaiI YATR 6 cut(s) 27, 29, 62, 71, 273, 275
FaqI GGGAC 1 cut(s) 69
FauNDI CATATG 1 cut(s) 27
Fnu4HI GCNGC 2 cut(s) 96, 156
Fsp4HI GCNGC 2 cut(s) 96, 156
FspBI CTAG 2 cut(s) 92, 313
GluI GCNGC 2 cut(s) 96, 156
GsuI CTGGAG 1 cut(s) 219
Hpy188I TCNGA 1 cut(s) 77
Hpy188III TCNNGA 1 cut(s) 236
HpyCH4III ACNGT 1 cut(s) 164
HpyCH4V TGCA 1 cut(s) 98
HpyF3I CTNAG 1 cut(s) 74
LpnPI CCDG 8 cut(s) 33, 38, 60, 193, 201, 227, 249, 254
Lsp1109I GCAGC 2 cut(s) 82, 167
LweI GCATC 1 cut(s) 177
MaeI CTAG 2 cut(s) 92, 313
MaeIII GTNAC 1 cut(s) 307
MluCI AATT 1 cut(s) 12
MnlI CCTC 1 cut(s) 243
MroXI GAANNNNTTC 1 cut(s) 15
MslI CAYNNNNRTG 1 cut(s) 26
MspR9I CCNGG 2 cut(s) 48, 242
MvaI CCWGG 2 cut(s) 48, 242
NdeI CATATG 1 cut(s) 27
NlaIV GGNNCC 1 cut(s) 246
PdmI GAANNNNTTC 1 cut(s) 15
PfoI TCCNGGA 1 cut(s) 46
PkrI GCNGC 2 cut(s) 97, 157
PpuMI RGGWCCY 1 cut(s) 244
PshAI GACNNNNGTC 1 cut(s) 228
Psp5II RGGWCCY 1 cut(s) 244
Psp6I CCWGG 2 cut(s) 46, 240
PspEI GGTNACC 1 cut(s) 307
PspGI CCWGG 2 cut(s) 46, 240
PspN4I GGNNCC 1 cut(s) 246
PspPI GGNCC 2 cut(s) 230, 244
PspPPI RGGWCCY 1 cut(s) 244
RseI CAYNNNNRTG 1 cut(s) 26
SatI GCNGC 2 cut(s) 96, 156
Sau96I GGNCC 2 cut(s) 230, 244
ScrFI CCNGG 2 cut(s) 48, 242
SetI ASST 5 cut(s) 97, 119, 190, 212, 314
SfaNI GCATC 1 cut(s) 177
SinI GGWCC 2 cut(s) 230, 244
SmiMI CAYNNNNRTG 1 cut(s) 26
Sse9I AATT 1 cut(s) 12
SspMI CTAG 2 cut(s) 92, 313
StyD4I CCNGG 2 cut(s) 46, 240
TaaI ACNGT 1 cut(s) 164
TasI AATT 1 cut(s) 12
TscAI CASTG 2 cut(s) 133, 285
TseI GCWGC 2 cut(s) 95, 155
TspDTI ATGAA 1 cut(s) 192
TspGWI ACGGA 1 cut(s) 272
TspRI CASTG 2 cut(s) 133, 285
VpaK11BI GGWCC 2 cut(s) 230, 244
XmnI GAANNNNTTC 1 cut(s) 15
XspI CTAG 2 cut(s) 92, 313
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.