MD13G1185600.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Forward (+)
15791269 .. 15792514
1246 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1185600.v1.1.491

Sequence Viewer

Length: 369 bp
ATGGAAGTTGCCATGGAGAAACTAGAGGATGACTTGTTCTTTGCAGAATTAACTAAGCAAATTTCCCTTCTAATTATGGATGATGAGGAGGACCCTATTGCAACTTACCCTTCAGTTTCTCTTCAGGCTTTCTCTTGTGCAATCCATCCACCTGCACATCCTGTCCTTCTGTATGAGCATTCCTGCAGAAGAGAAACCAAAGGAACTGGAGTTTTCATCCCCCAATCAACACATTCAAGAAGAAAGCACAGACAGGGAAGGTTTGCTTCATACAACCCAAAATCCCACGGATCGTCACAAGCTGATCACAACAAAAGGATGGTTTCCCAAGTATCTTCGGACTGCGCTTTTAGACCGAAAAATGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

13.77

Weight (kDa)

7.05

Isoelectric Point (pI)

57.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012980)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 160
Acc36I ACCTGC 1 cut(s) 160
AclWI GGATC 1 cut(s) 298
AcsI RAATTY 1 cut(s) 60
AcuI CTGAAG 2 cut(s) 96, 107
AfiI CCNNNNNNNGG 1 cut(s) 362
AgsI TTSAA 1 cut(s) 237
AloI GAACNNNNNNTCC 2 cut(s) 20, 52
AluBI AGCT 1 cut(s) 302
AluI AGCT 1 cut(s) 302
AlwI GGATC 1 cut(s) 298
ApoI RAATTY 1 cut(s) 60
ArsI GACNNNNNNTTYG 2 cut(s) 23, 55
AspLEI GCGC 1 cut(s) 347
AspS9I GGNCC 1 cut(s) 91
AvaII GGWCC 1 cut(s) 91
BccI CCATC 2 cut(s) 153, 313
BclI TGATCA 1 cut(s) 304
BfaI CTAG 1 cut(s) 23
BfmI CTRYAG 1 cut(s) 184
BfuAI ACCTGC 1 cut(s) 160
Bme18I GGWCC 1 cut(s) 91
BmgT120I GGNCC 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 93
BpmI CTGGAG 1 cut(s) 228
BsaJI CCNNGG 2 cut(s) 12, 286
Bsc4I CCNNNNNNNGG 1 cut(s) 362
Bse1I ACTGG 1 cut(s) 211
BseDI CCNNGG 2 cut(s) 12, 286
BseGI GGATG 6 cut(s) 34, 85, 145, 157, 216, 324
BseLI CCNNNNNNNGG 1 cut(s) 362
BseNI ACTGG 1 cut(s) 211
BseRI GAGGAG 1 cut(s) 101
BsgI GTGCAG 1 cut(s) 138
BslI CCNNNNNNNGG 1 cut(s) 362
BsmI GAATGC 1 cut(s) 178
Bsp143I GATC 2 cut(s) 290, 304
Bsp19I CCATGG 1 cut(s) 12
BspLI GGNNCC 1 cut(s) 93
BspMAI CTGCAG 1 cut(s) 188
BspMI ACCTGC 1 cut(s) 160
BspPI GGATC 1 cut(s) 298
BsrI ACTGG 1 cut(s) 211
BssECI CCNNGG 2 cut(s) 12, 286
BssMI GATC 2 cut(s) 290, 304
BssT1I CCWWGG 1 cut(s) 12
Bst6I CTCTTC 2 cut(s) 126, 184
BstDEI CTNAG 1 cut(s) 54
BstDSI CCRYGG 2 cut(s) 12, 286
BstF5I GGATG 6 cut(s) 34, 85, 145, 157, 216, 324
BstHHI GCGC 1 cut(s) 347
BstKTI GATC 2 cut(s) 293, 307
BstMBI GATC 2 cut(s) 290, 304
BstSFI CTRYAG 1 cut(s) 184
BtgI CCRYGG 2 cut(s) 12, 286
BtsCI GGATG 6 cut(s) 34, 85, 145, 157, 216, 324
BveI ACCTGC 1 cut(s) 160
CfoI GCGC 1 cut(s) 347
Cfr13I GGNCC 1 cut(s) 91
CviAII CATG 1 cut(s) 13
CviJI RGCY 2 cut(s) 128, 302
CviKI_1 RGCY 2 cut(s) 128, 302
DdeI CTNAG 1 cut(s) 54
DpnI GATC 2 cut(s) 292, 306
DpnII GATC 2 cut(s) 290, 304
Eam1104I CTCTTC 2 cut(s) 126, 184
EarI CTCTTC 2 cut(s) 126, 184
Eco130I CCWWGG 1 cut(s) 12
Eco47I GGWCC 1 cut(s) 91
Eco57I CTGAAG 2 cut(s) 96, 107
EcoO109I RGGNCCY 1 cut(s) 91
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaeI CATG 1 cut(s) 16
FaiI YATR 4 cut(s) 14, 77, 174, 271
FalI AAGNNNNNCTT 2 cut(s) 250, 282
FatI CATG 1 cut(s) 12
FbaI TGATCA 1 cut(s) 304
FokI GGATG 6 cut(s) 41, 92, 132, 144, 203, 331
FspBI CTAG 1 cut(s) 23
GlaI GCGC 1 cut(s) 346
GsuI CTGGAG 1 cut(s) 228
HhaI GCGC 1 cut(s) 347
Hin1II CATG 1 cut(s) 16
Hin6I GCGC 1 cut(s) 345
HinP1I GCGC 1 cut(s) 345
Hpy188I TCNGA 1 cut(s) 340
Hpy188III TCNNGA 1 cut(s) 237
HpyAV CCTTC 4 cut(s) 77, 120, 176, 252
HpyCH4V TGCA 5 cut(s) 44, 101, 140, 155, 186
HpyF3I CTNAG 1 cut(s) 54
Hsp92II CATG 1 cut(s) 16
HspAI GCGC 1 cut(s) 345
Ksp22I TGATCA 1 cut(s) 304
Kzo9I GATC 2 cut(s) 290, 304
LpnPI CCDG 6 cut(s) 110, 165, 174, 192, 196, 239
MaeI CTAG 1 cut(s) 23
MaeIII GTNAC 1 cut(s) 294
MalI GATC 2 cut(s) 292, 306
MboI GATC 2 cut(s) 290, 304
MboII GAAGA 4 cut(s) 113, 201, 252, 327
MluCI AATT 3 cut(s) 47, 60, 72
MnlI CCTC 3 cut(s) 19, 79, 82
MseI TTAA 1 cut(s) 50
Mva1269I GAATGC 1 cut(s) 178
NcoI CCATGG 1 cut(s) 12
NdeII GATC 2 cut(s) 290, 304
NlaIII CATG 1 cut(s) 16
NlaIV GGNNCC 1 cut(s) 93
NmuCI GTSAC 1 cut(s) 294
PaqCI CACCTGC 1 cut(s) 160
PctI GAATGC 1 cut(s) 178
PpuMI RGGWCCY 1 cut(s) 91
Psp5II RGGWCCY 1 cut(s) 91
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 1 cut(s) 91
PspPPI RGGWCCY 1 cut(s) 91
PstI CTGCAG 1 cut(s) 188
SaqAI TTAA 1 cut(s) 50
Sau3AI GATC 2 cut(s) 290, 304
Sau96I GGNCC 1 cut(s) 91
SetI ASST 3 cut(s) 154, 263, 304
SfcI CTRYAG 1 cut(s) 184
SinI GGWCC 1 cut(s) 91
Sse9I AATT 3 cut(s) 47, 60, 72
SspMI CTAG 1 cut(s) 23
StyI CCWWGG 1 cut(s) 12
TasI AATT 3 cut(s) 47, 60, 72
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TseFI GTSAC 1 cut(s) 294
Tsp45I GTSAC 1 cut(s) 294
TspDTI ATGAA 2 cut(s) 205, 258
TspGWI ACGGA 1 cut(s) 303
VpaK11BI GGWCC 1 cut(s) 91
XapI RAATTY 1 cut(s) 60
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.