Rmu_sc0004142.1_g000012

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004142.1
Physical Location & Seq
Forward (+)
47834 .. 48395
562 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004142.1_g000012.1.cds

Sequence Viewer

Length: 390 bp
atggaggtggccaaggagcttgaagatgacttgttctttgcagacttgactaagcaaatctctcttcttatcatggatgatgatgatcaagaccctattgccacttgcccttctgtttctcttcaggctttctcttgtgcaattcatccaccagttcaagtccctgcttatctgtatgagcaatcttgcaaaagagaaaccaaaggaactggagttttcatcccgcaatcgacagcgccgagaagaaggcataataggccagggaaatacactaatgcatacaacaacacaaaaccccacaacagatcacaagctgatcagcgcaacaggaaaatggtttcccaactaccttcagactttgcttttagaccaagaaatggcagagagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

14.73

Weight (kDa)

8.49

Isoelectric Point (pI)

65.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012980)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 377
AciI CCGC 1 cut(s) 224
AcoI YGGCCR 1 cut(s) 9
AcuI CTGAAG 2 cut(s) 107, 336
AfiI CCNNNNNNNGG 1 cut(s) 377
AgsI TTSAA 2 cut(s) 23, 158
AjnI CCWGG 1 cut(s) 259
AluBI AGCT 2 cut(s) 19, 314
AluI AGCT 2 cut(s) 19, 314
AoxI GGCC 2 cut(s) 9, 257
ArsI GACNNNNNNTTYG 2 cut(s) 20, 52
AspLEI GCGC 2 cut(s) 238, 324
BalI TGGCCA 1 cut(s) 11
BciT130I CCWGG 1 cut(s) 261
BclI TGATCA 2 cut(s) 85, 316
BfoI RGCGCY 1 cut(s) 239
Bme1390I CCNGG 1 cut(s) 261
BmrFI CCNGG 1 cut(s) 261
BpmI CTGGAG 1 cut(s) 231
BsaBI GATNNNNATC 1 cut(s) 84
BsaJI CCNNGG 2 cut(s) 12, 260
Bsc4I CCNNNNNNNGG 1 cut(s) 377
Bse1I ACTGG 2 cut(s) 152, 214
Bse8I GATNNNNATC 1 cut(s) 84
BseBI CCWGG 1 cut(s) 261
BseDI CCNNGG 2 cut(s) 12, 260
BseGI GGATG 3 cut(s) 82, 145, 219
BseJI GATNNNNATC 1 cut(s) 84
BseLI CCNNNNNNNGG 1 cut(s) 377
BseNI ACTGG 2 cut(s) 152, 214
BshFI GGCC 2 cut(s) 11, 259
BslFI GGGAC 1 cut(s) 146
BslI CCNNNNNNNGG 1 cut(s) 377
BsmFI GGGAC 1 cut(s) 146
BsnI GGCC 2 cut(s) 11, 259
Bsp143I GATC 3 cut(s) 85, 305, 316
BspACI CCGC 1 cut(s) 224
BspANI GGCC 2 cut(s) 11, 259
BsrI ACTGG 2 cut(s) 152, 214
BssECI CCNNGG 2 cut(s) 12, 260
BssMI GATC 3 cut(s) 85, 305, 316
BssT1I CCWWGG 1 cut(s) 12
Bst2UI CCWGG 1 cut(s) 261
Bst6I CTCTTC 2 cut(s) 69, 126
BstDEI CTNAG 1 cut(s) 51
BstF5I GGATG 3 cut(s) 82, 145, 219
BstH2I RGCGCY 1 cut(s) 239
BstHHI GCGC 2 cut(s) 238, 324
BstKTI GATC 3 cut(s) 88, 308, 319
BstMBI GATC 3 cut(s) 85, 305, 316
BstMWI GCNNNNNNNGC 1 cut(s) 256
BstNI CCWGG 1 cut(s) 261
BstSCI CCNGG 1 cut(s) 259
BsuRI GGCC 2 cut(s) 11, 259
BtsCI GGATG 3 cut(s) 82, 145, 219
CfoI GCGC 2 cut(s) 238, 324
CviAII CATG 1 cut(s) 73
CviJI RGCY 5 cut(s) 11, 19, 128, 259, 314
CviKI_1 RGCY 5 cut(s) 11, 19, 128, 259, 314
DdeI CTNAG 1 cut(s) 51
DpnI GATC 3 cut(s) 87, 307, 318
DpnII GATC 3 cut(s) 85, 305, 316
EaeI YGGCCR 1 cut(s) 9
Eam1104I CTCTTC 2 cut(s) 69, 126
EarI CTCTTC 2 cut(s) 69, 126
Eco130I CCWWGG 1 cut(s) 12
Eco57I CTGAAG 2 cut(s) 107, 336
EcoRII CCWGG 1 cut(s) 259
EcoT14I CCWWGG 1 cut(s) 12
EcoT22I ATGCAT 1 cut(s) 280
ErhI CCWWGG 1 cut(s) 12
FaeI CATG 1 cut(s) 76
FaiI YATR 4 cut(s) 74, 177, 252, 280
FaqI GGGAC 1 cut(s) 146
FatI CATG 1 cut(s) 72
FauI CCCGC 1 cut(s) 231
FbaI TGATCA 2 cut(s) 85, 316
FokI GGATG 3 cut(s) 89, 132, 206
GlaI GCGC 2 cut(s) 237, 323
GsuI CTGGAG 1 cut(s) 231
HaeII RGCGCY 1 cut(s) 239
HaeIII GGCC 2 cut(s) 11, 259
HhaI GCGC 2 cut(s) 238, 324
Hin1II CATG 1 cut(s) 76
Hin6I GCGC 2 cut(s) 236, 322
HinP1I GCGC 2 cut(s) 236, 322
Hpy188I TCNGA 1 cut(s) 355
Hpy188III TCNNGA 1 cut(s) 89
HpyAV CCTTC 3 cut(s) 120, 240, 360
HpyCH4V TGCA 4 cut(s) 41, 140, 189, 278
HpyF10VI GCNNNNNNNGC 1 cut(s) 256
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 1 cut(s) 76
HspAI GCGC 2 cut(s) 236, 322
Ksp22I TGATCA 2 cut(s) 85, 316
Kzo9I GATC 3 cut(s) 85, 305, 316
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 7 cut(s) 110, 165, 177, 195, 246, 273, 313
MalI GATC 3 cut(s) 87, 307, 318
MboI GATC 3 cut(s) 85, 305, 316
MboII GAAGA 4 cut(s) 35, 56, 113, 255
MlsI TGGCCA 1 cut(s) 11
MluCI AATT 1 cut(s) 141
MluNI TGGCCA 1 cut(s) 11
Mox20I TGGCCA 1 cut(s) 11
Mph1103I ATGCAT 1 cut(s) 280
MscI TGGCCA 1 cut(s) 11
Msp20I TGGCCA 1 cut(s) 11
MspR9I CCNGG 1 cut(s) 261
MvaI CCWGG 1 cut(s) 261
MwoI GCNNNNNNNGC 1 cut(s) 256
NdeII GATC 3 cut(s) 85, 305, 316
NlaIII CATG 1 cut(s) 76
NmeAIII GCCGAG 1 cut(s) 264
NsiI ATGCAT 1 cut(s) 280
PcsI WCGNNNNNNNCGW 1 cut(s) 236
PflMI CCANNNNNTGG 1 cut(s) 377
Psp6I CCWGG 1 cut(s) 259
PspGI CCWGG 1 cut(s) 259
Sau3AI GATC 3 cut(s) 85, 305, 316
ScrFI CCNGG 1 cut(s) 261
SetI ASST 4 cut(s) 9, 21, 316, 352
Sse9I AATT 1 cut(s) 141
SsiI CCGC 1 cut(s) 224
StyD4I CCNGG 1 cut(s) 259
StyI CCWWGG 1 cut(s) 12
TaqI TCGA 1 cut(s) 230
TasI AATT 1 cut(s) 141
TspDTI ATGAA 2 cut(s) 134, 208
Van91I CCANNNNNTGG 1 cut(s) 377
Zsp2I ATGCAT 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.