Prupe.1G153300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
12089214 .. 12091842
2629 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G153300.2

Sequence Viewer

Length: 360 bp
ATGGAAAAGCTTGAAGATGACTTGTTCTTTGCAGACTTAACTAGGCAAATCTCTCTGCTAATTATGGATGATGATGAGGACCCTGTTGCAACTTGCCCTTCAGTTTCTCTTCAGGCTTTCTCCTGTGCAATCCATCATCCACCTGCACAACCTACTTCTCTGTATGAACAATCTCGCAGAAGAGAAACCAAAGGAACAGGGGTTTTTATCCCCCAGTCATCTCAGCCAAGAAGAAAGCACAGGCAGGGAAGGTTTGCGTCGTACAACACAAAATCCCACAGATCATCACAAACTGATCATCACAAAAGGACGGTTTCCCAAGTATCTTCTGACTGTGCTTTTAGACCCAAAAATGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

13.53

Weight (kDa)

8.93

Isoelectric Point (pI)

72.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012980)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 151
Acc36I ACCTGC 1 cut(s) 151
AcuI CTGAAG 2 cut(s) 84, 95
AfaI GTAC 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 353
AgsI TTSAA 1 cut(s) 14
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
ArsI GACNNNNNNTTYG 2 cut(s) 11, 43
AspS9I GGNCC 1 cut(s) 79
AvaII GGWCC 1 cut(s) 79
BccI CCATC 1 cut(s) 141
BclI TGATCA 1 cut(s) 295
BfaI CTAG 1 cut(s) 42
BfuAI ACCTGC 1 cut(s) 151
Bme18I GGWCC 1 cut(s) 79
BmgT120I GGNCC 1 cut(s) 79
BmiI GGNNCC 1 cut(s) 81
BmrI ACTGGG 1 cut(s) 208
BmuI ACTGGG 1 cut(s) 208
Bsc4I CCNNNNNNNGG 1 cut(s) 353
Bse1I ACTGG 1 cut(s) 214
BseGI GGATG 2 cut(s) 73, 136
BseLI CCNNNNNNNGG 1 cut(s) 353
BseMII CTCAG 1 cut(s) 236
BseNI ACTGG 1 cut(s) 214
BsgI GTGCAG 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 353
Bsp143I GATC 2 cut(s) 281, 295
BspCNI CTCAG 1 cut(s) 235
BspLI GGNNCC 1 cut(s) 81
BspMI ACCTGC 1 cut(s) 151
BsrI ACTGG 1 cut(s) 214
BssMI GATC 2 cut(s) 281, 295
Bst4CI ACNGT 2 cut(s) 313, 335
Bst6I CTCTTC 2 cut(s) 114, 175
BstDEI CTNAG 1 cut(s) 222
BstF5I GGATG 2 cut(s) 73, 136
BstKTI GATC 2 cut(s) 284, 298
BstMBI GATC 2 cut(s) 281, 295
BtsCI GGATG 2 cut(s) 73, 136
BveI ACCTGC 1 cut(s) 151
Cfr13I GGNCC 1 cut(s) 79
CseI GACGC 1 cut(s) 246
Csp6I GTAC 1 cut(s) 262
CviJI RGCY 3 cut(s) 10, 116, 226
CviKI_1 RGCY 3 cut(s) 10, 116, 226
CviQI GTAC 1 cut(s) 262
DdeI CTNAG 1 cut(s) 222
DpnI GATC 2 cut(s) 283, 297
DpnII GATC 2 cut(s) 281, 295
Eam1104I CTCTTC 2 cut(s) 114, 175
EarI CTCTTC 2 cut(s) 114, 175
Eco47I GGWCC 1 cut(s) 79
Eco57I CTGAAG 2 cut(s) 84, 95
EcoO109I RGGNCCY 1 cut(s) 79
FaiI YATR 2 cut(s) 65, 165
FbaI TGATCA 1 cut(s) 295
FokI GGATG 2 cut(s) 80, 123
FspBI CTAG 1 cut(s) 42
HgaI GACGC 1 cut(s) 246
HindIII AAGCTT 1 cut(s) 8
Hpy188I TCNGA 1 cut(s) 331
Hpy99I CGWCG 1 cut(s) 262
HpyAV CCTTC 2 cut(s) 108, 243
HpyCH4III ACNGT 2 cut(s) 313, 335
HpyCH4V TGCA 4 cut(s) 32, 89, 128, 146
HpyF3I CTNAG 1 cut(s) 222
Ksp22I TGATCA 1 cut(s) 295
Kzo9I GATC 2 cut(s) 281, 295
LpnPI CCDG 8 cut(s) 96, 98, 136, 156, 183, 226, 227, 230
MaeI CTAG 1 cut(s) 42
MalI GATC 2 cut(s) 283, 297
MboI GATC 2 cut(s) 281, 295
MboII GAAGA 5 cut(s) 26, 101, 192, 243, 318
MluCI AATT 1 cut(s) 60
MnlI CCTC 1 cut(s) 70
MseI TTAA 1 cut(s) 38
NdeII GATC 2 cut(s) 281, 295
NlaIV GGNNCC 1 cut(s) 81
PaqCI CACCTGC 1 cut(s) 151
PpuMI RGGWCCY 1 cut(s) 79
Psp5II RGGWCCY 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 81
PspPI GGNCC 1 cut(s) 79
PspPPI RGGWCCY 1 cut(s) 79
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
SaqAI TTAA 1 cut(s) 38
Sau3AI GATC 2 cut(s) 281, 295
Sau96I GGNCC 1 cut(s) 79
SetI ASST 4 cut(s) 12, 145, 154, 254
SinI GGWCC 1 cut(s) 79
Sse9I AATT 1 cut(s) 60
SspMI CTAG 1 cut(s) 42
TaaI ACNGT 2 cut(s) 313, 335
TasI AATT 1 cut(s) 60
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
TspDTI ATGAA 1 cut(s) 180
VpaK11BI GGWCC 1 cut(s) 79
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.