MD14G1072800.v1.1

Serine arginine repetitive matrix protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0012049
Physical Location & Seq
Reverse (-)
8108567 .. 8109416
850 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1072800.v1.1.491

Sequence Viewer

Length: 315 bp
ATGGAGGACCAGGAGTCTTCTGGCAGCAACAGCTTTGTGAGCGGTAGTTCTCGTTCGCAACAACATAATTGGGGCTTCTCTTCTTCATGGGAACCCAATTCAGCTGACTCCACTGATTGCTGGGCTTCAAGATCCAGCACCAAAGAGGAGGATCACAAAACTCCGCTGAGTTTTGAGAAGGATGAAGCTGCCAAGAGGAGATTGACTGGCCACCACCACCAGCGCAGTGGTGGGATTGGGCGTGGGAGGCTTGCTACCATCAACGCCAAAGGGCTTCCTAGACTTCCAGGTATTGCTGCTGCAGCTTCAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.24

Weight (kDa)

8.0

Isoelectric Point (pI)

64.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012049)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G65710 AT5G37010
fragaria_vesca FvH4_5g39710
malus_domestica MD12G1074700.v1.1 MD14G1072800.v1.1
prunus_persica Prupe.7G058700_v2.0.a1 Prupe.7G058800_v2.0.a1
pyrus_communis pycom12g06450 pycom14g06270
rosa_chinensis RchiOBHm_Chr7g0242011
rosa_laevigata RLG00000000517
rosa_multiflora Rmu_sc0003559.1_g000015
rosa_roxburghii Rroxscaffold_3G00218280
rosa_rugosa Rorug07G0349800
rosa_samantha Rh7AG504500 Rh7BG476300 Rh7CG521000 Rh7DG490100
rosa_wichuraiana Rw7G042640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 42
AciI CCGC 2 cut(s) 42, 164
AclWI GGATC 2 cut(s) 126, 159
AcoI YGGCCR 1 cut(s) 208
AgsI TTSAA 2 cut(s) 129, 309
AhdI GACNNNNNGTC 1 cut(s) 13
AjnI CCWGG 2 cut(s) 9, 286
AluBI AGCT 4 cut(s) 33, 104, 188, 305
AluI AGCT 4 cut(s) 33, 104, 188, 305
AlwI GGATC 2 cut(s) 126, 159
AoxI GGCC 1 cut(s) 208
ApeKI GCWGC 5 cut(s) 24, 188, 296, 299, 302
AspLEI GCGC 1 cut(s) 225
AspS9I GGNCC 1 cut(s) 7
AvaII GGWCC 1 cut(s) 7
BalI TGGCCA 1 cut(s) 210
BbsI GAAGAC 1 cut(s) 9
BbvI GCAGC 4 cut(s) 36, 175, 283, 286
BccI CCATC 1 cut(s) 266
BciT130I CCWGG 2 cut(s) 11, 288
BfaI CTAG 1 cut(s) 279
BfmI CTRYAG 1 cut(s) 300
BisI GCNGC 5 cut(s) 25, 189, 297, 300, 303
BlsI GCNGC 5 cut(s) 26, 190, 298, 301, 304
Bme1390I CCNGG 2 cut(s) 11, 288
Bme18I GGWCC 1 cut(s) 7
BmeRI GACNNNNNGTC 1 cut(s) 13
BmgT120I GGNCC 1 cut(s) 7
BmiI GGNNCC 1 cut(s) 93
BmrFI CCNGG 2 cut(s) 11, 288
BpiI GAAGAC 1 cut(s) 9
Bse1I ACTGG 1 cut(s) 211
BseBI CCWGG 2 cut(s) 11, 288
BseGI GGATG 1 cut(s) 187
BseMII CTCAG 1 cut(s) 158
BseNI ACTGG 1 cut(s) 211
BseRI GAGGAG 2 cut(s) 161, 211
BseXI GCAGC 4 cut(s) 36, 175, 283, 286
BseYI CCCAGC 1 cut(s) 120
BshFI GGCC 1 cut(s) 210
BsnI GGCC 1 cut(s) 210
Bsp143I GATC 2 cut(s) 131, 151
BspACI CCGC 2 cut(s) 42, 164
BspANI GGCC 1 cut(s) 210
BspCNI CTCAG 1 cut(s) 159
BspLI GGNNCC 1 cut(s) 93
BspMAI CTGCAG 1 cut(s) 304
BspPI GGATC 2 cut(s) 126, 159
BsrBI CCGCTC 1 cut(s) 42
BsrI ACTGG 1 cut(s) 211
BssMI GATC 2 cut(s) 131, 151
Bst2UI CCWGG 2 cut(s) 11, 288
Bst6I CTCTTC 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 252
BstDEI CTNAG 1 cut(s) 167
BstF5I GGATG 1 cut(s) 187
BstHHI GCGC 1 cut(s) 225
BstKTI GATC 2 cut(s) 134, 154
BstMBI GATC 2 cut(s) 131, 151
BstMWI GCNNNNNNNGC 4 cut(s) 30, 39, 247, 302
BstNI CCWGG 2 cut(s) 11, 288
BstSCI CCNGG 2 cut(s) 9, 286
BstSFI CTRYAG 1 cut(s) 300
BstV1I GCAGC 4 cut(s) 36, 175, 283, 286
BstV2I GAAGAC 1 cut(s) 9
BstX2I RGATCY 1 cut(s) 131
BstXI CCANNNNNNTGG 1 cut(s) 227
BstYI RGATCY 1 cut(s) 131
BsuRI GGCC 1 cut(s) 210
BtsCI GGATG 1 cut(s) 187
BtsI GCAGTG 1 cut(s) 232
BtsIMutI CAGTG 2 cut(s) 111, 232
Cac8I GCNNGC 1 cut(s) 252
CfoI GCGC 1 cut(s) 225
Cfr13I GGNCC 1 cut(s) 7
CviAII CATG 1 cut(s) 87
CviJI RGCY 9 cut(s) 33, 75, 104, 125, 188, 210, 250, 274, 305
CviKI_1 RGCY 9 cut(s) 33, 75, 104, 125, 188, 210, 250, 274, 305
DdeI CTNAG 1 cut(s) 167
DpnI GATC 2 cut(s) 133, 153
DpnII GATC 2 cut(s) 131, 151
DriI GACNNNNNGTC 1 cut(s) 13
EaeI YGGCCR 1 cut(s) 208
Eam1104I CTCTTC 1 cut(s) 85
Eam1105I GACNNNNNGTC 1 cut(s) 13
EarI CTCTTC 1 cut(s) 85
Eco47I GGWCC 1 cut(s) 7
EcoRII CCWGG 2 cut(s) 9, 286
FaeI CATG 1 cut(s) 90
FaiI YATR 2 cut(s) 66, 88
FatI CATG 1 cut(s) 86
Fnu4HI GCNGC 5 cut(s) 25, 189, 297, 300, 303
FokI GGATG 1 cut(s) 194
Fsp4HI GCNGC 5 cut(s) 25, 189, 297, 300, 303
FspBI CTAG 1 cut(s) 279
GlaI GCGC 1 cut(s) 224
GluI GCNGC 5 cut(s) 25, 189, 297, 300, 303
GsaI CCCAGC 1 cut(s) 124
HaeIII GGCC 1 cut(s) 210
HhaI GCGC 1 cut(s) 225
Hin1II CATG 1 cut(s) 90
Hin6I GCGC 1 cut(s) 223
HinP1I GCGC 1 cut(s) 223
HinfI GANTC 2 cut(s) 14, 107
Hpy188III TCNNGA 1 cut(s) 129
HpyAV CCTTC 1 cut(s) 172
HpyCH4V TGCA 1 cut(s) 302
HpyF10VI GCNNNNNNNGC 4 cut(s) 30, 39, 247, 302
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 1 cut(s) 90
HspAI GCGC 1 cut(s) 223
Kzo9I GATC 2 cut(s) 131, 151
LpnPI CCDG 8 cut(s) 6, 23, 106, 148, 192, 233, 273, 300
Lsp1109I GCAGC 4 cut(s) 36, 175, 283, 286
MaeI CTAG 1 cut(s) 279
MalI GATC 2 cut(s) 133, 153
MbiI CCGCTC 1 cut(s) 42
MboI GATC 2 cut(s) 131, 151
MboII GAAGA 3 cut(s) 9, 72, 75
MflI RGATCY 1 cut(s) 131
MlsI TGGCCA 1 cut(s) 210
MluCI AATT 2 cut(s) 67, 97
MluNI TGGCCA 1 cut(s) 210
MlyI GAGTC 2 cut(s) 23, 101
MnlI CCTC 4 cut(s) 139, 142, 189, 240
Mox20I TGGCCA 1 cut(s) 210
MscI TGGCCA 1 cut(s) 210
Msp20I TGGCCA 1 cut(s) 210
MspA1I CMGCKG 2 cut(s) 104, 166
MspR9I CCNGG 2 cut(s) 11, 288
MvaI CCWGG 2 cut(s) 11, 288
MwoI GCNNNNNNNGC 4 cut(s) 30, 39, 247, 302
NdeII GATC 2 cut(s) 131, 151
NlaIII CATG 1 cut(s) 90
NlaIV GGNNCC 1 cut(s) 93
PkrI GCNGC 5 cut(s) 26, 190, 298, 301, 304
PleI GAGTC 2 cut(s) 22, 101
PpsI GAGTC 2 cut(s) 22, 101
Psp6I CCWGG 2 cut(s) 9, 286
PspFI CCCAGC 1 cut(s) 120
PspGI CCWGG 2 cut(s) 9, 286
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 1 cut(s) 7
PsrI GAACNNNNNNTAC 2 cut(s) 37, 69
PstI CTGCAG 1 cut(s) 304
PsuI RGATCY 1 cut(s) 131
PvuII CAGCTG 1 cut(s) 104
SatI GCNGC 5 cut(s) 25, 189, 297, 300, 303
Sau3AI GATC 2 cut(s) 131, 151
Sau96I GGNCC 1 cut(s) 7
SchI GAGTC 2 cut(s) 23, 101
ScrFI CCNGG 2 cut(s) 11, 288
SetI ASST 5 cut(s) 35, 106, 190, 292, 307
SfcI CTRYAG 1 cut(s) 300
SinI GGWCC 1 cut(s) 7
Sse9I AATT 2 cut(s) 67, 97
SsiI CCGC 2 cut(s) 42, 164
SspMI CTAG 1 cut(s) 279
StyD4I CCNGG 2 cut(s) 9, 286
TasI AATT 2 cut(s) 67, 97
TscAI CASTG 2 cut(s) 118, 232
TseI GCWGC 5 cut(s) 24, 188, 296, 299, 302
TspDTI ATGAA 2 cut(s) 75, 198
TspRI CASTG 2 cut(s) 118, 232
VpaK11BI GGWCC 1 cut(s) 7
XcmI CCANNNNNNNNNTGG 3 cut(s) 17, 224, 227
XspI CTAG 1 cut(s) 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.