MD14G1101600.v1.1

LURP-one-related

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0011668
Physical Location & Seq
Reverse (-)
15656997 .. 15657805
809 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1101600.v1.1.491

Sequence Viewer

Length: 600 bp
ATGGCTAACGTGTGTCCTCCAGCTCCCCAAGTTCTCTCTCTATCTCGCTACACTAATAGTTCATCAAAGAGAGACACTTATACCATTTGGATGAAATCACTTGTATGTCATACAAATGGTTGCACTGTTTACAATTCCAGTGGCAACATTGTTTATCGTGTCGACAACTACGACAAAAAGTGTAGCAACGAAGTCCATCTCATGGATCTCCAAGGCAAAGTCCTCTATACTATATGCAAAAAGAAATTAAAAGCTTTTGAGCAATGGGATGGCTACAGAACTAGTAGCCCTTCTAATAGAAACAAGGAGAAGCCTGGGTTTCAAGTGAAAAGTTATAGTAGAATGCTCATGGGAACCACAGCTTGTCAAATTACAGTAGAGTGTGACAAGTATTGGATAGTGGCAGGGAAGAGTGGTGCTGTGGGATATAGAATAGTAGACATTGATGAACATATTGTTGCAGAGGCGAAGCAGAAGCTATCATCATCTGGAGTAGTTCTGGGGGATGATGTCTTAACTTTAGAGGTGGTTCCTCATATGGACCATTCCTTTATAATGGCTATTGTGATTGTGTATGGATTGATTTGTCGCAAAATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LOR

Protein Analysis

200

Amino Acids

22.35

Weight (kDa)

8.94

Isoelectric Point (pI)

30.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LOR PF04525 26 - 192 7.1e-33 LURP-one-related
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011668)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G63410 AT1G63410 AT1G63410
fragaria_vesca FvH4_5g02030 FvH4_5g02030
malus_domestica MD06G1080200.v1.1 MD14G1101600.v1.1
prunus_persica Prupe.5G096800_v2.0.a1
pyrus_communis pycom06g07720
rosa_chinensis RchiOBHm_Chr7g0198311
rosa_laevigata RLG00000003877
rosa_multiflora Rmu_sc0001250.1_g000038
rosa_roxburghii Rroxscaffold_3G00257850
rosa_rugosa Rorug07G0046800
rosa_samantha Rh7AG170300 Rh7BG173400 Rh7CG181000 Rh7DG172500
rosa_wichuraiana Rw7G014910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 554
AccB7I CCANNNNNTGG 1 cut(s) 202
AccI GTMKAC 2 cut(s) 162, 438
AclWI GGATC 1 cut(s) 213
AfiI CCNNNNNNNGG 1 cut(s) 202
AflIII ACRYGT 1 cut(s) 9
AgsI TTSAA 1 cut(s) 323
AhlI ACTAGT 1 cut(s) 281
AjnI CCWGG 1 cut(s) 313
AluBI AGCT 4 cut(s) 23, 254, 362, 478
AluI AGCT 4 cut(s) 23, 254, 362, 478
Alw26I GTCTC 1 cut(s) 66
AlwI GGATC 1 cut(s) 213
AspS9I GGNCC 1 cut(s) 541
AvaII GGWCC 1 cut(s) 541
BccI CCATC 2 cut(s) 204, 263
BciT130I CCWGG 1 cut(s) 315
BcoDI GTCTC 1 cut(s) 66
BcuI ACTAGT 1 cut(s) 281
BfaI CTAG 1 cut(s) 282
BfmI CTRYAG 1 cut(s) 274
Bme1390I CCNGG 1 cut(s) 315
Bme18I GGWCC 1 cut(s) 541
BmgT120I GGNCC 1 cut(s) 541
BmiI GGNNCC 2 cut(s) 355, 531
BmrFI CCNGG 1 cut(s) 315
BpmI CTGGAG 1 cut(s) 510
BsaJI CCNNGG 2 cut(s) 211, 314
Bsc4I CCNNNNNNNGG 1 cut(s) 202
Bse1I ACTGG 1 cut(s) 138
Bse3DI GCAATG 1 cut(s) 269
BseBI CCWGG 1 cut(s) 315
BseDI CCNNGG 2 cut(s) 211, 314
BseGI GGATG 3 cut(s) 96, 274, 511
BseLI CCNNNNNNNGG 1 cut(s) 202
BseMI GCAATG 1 cut(s) 269
BseNI ACTGG 1 cut(s) 138
BslI CCNNNNNNNGG 1 cut(s) 202
BsmAI GTCTC 1 cut(s) 66
BsmI GAATGC 1 cut(s) 348
Bsp143I GATC 1 cut(s) 205
BspLI GGNNCC 2 cut(s) 355, 531
BspPI GGATC 1 cut(s) 213
BsrDI GCAATG 1 cut(s) 269
BsrI ACTGG 1 cut(s) 138
BssECI CCNNGG 2 cut(s) 211, 314
BssMI GATC 1 cut(s) 205
BssT1I CCWWGG 1 cut(s) 211
Bst2UI CCWGG 1 cut(s) 315
Bst4CI ACNGT 2 cut(s) 127, 376
Bst6I CTCTTC 1 cut(s) 404
BstF5I GGATG 3 cut(s) 96, 274, 511
BstKTI GATC 1 cut(s) 208
BstMAI GTCTC 1 cut(s) 66
BstMBI GATC 1 cut(s) 205
BstNI CCWGG 1 cut(s) 315
BstSCI CCNGG 1 cut(s) 313
BstSFI CTRYAG 1 cut(s) 274
BstX2I RGATCY 1 cut(s) 205
BstYI RGATCY 1 cut(s) 205
BtsCI GGATG 3 cut(s) 96, 274, 511
BtsIMutI CAGTG 2 cut(s) 123, 145
Cfr13I GGNCC 1 cut(s) 541
CspCI CAANNNNNGTGG 2 cut(s) 121, 156
CviAII CATG 2 cut(s) 202, 349
CviJI RGCY 9 cut(s) 5, 23, 254, 273, 288, 313, 362, 478, 560
CviKI_1 RGCY 9 cut(s) 5, 23, 254, 273, 288, 313, 362, 478, 560
DpnI GATC 1 cut(s) 207
DpnII GATC 1 cut(s) 205
Eam1104I CTCTTC 1 cut(s) 404
EarI CTCTTC 1 cut(s) 404
Eco130I CCWWGG 1 cut(s) 211
Eco47I GGWCC 1 cut(s) 541
EcoRII CCWGG 1 cut(s) 313
EcoT14I CCWWGG 1 cut(s) 211
ErhI CCWWGG 1 cut(s) 211
FaeI CATG 2 cut(s) 205, 352
FatI CATG 2 cut(s) 201, 348
FauNDI CATATG 1 cut(s) 537
FblI GTMKAC 2 cut(s) 162, 438
FokI GGATG 3 cut(s) 103, 281, 518
FspBI CTAG 1 cut(s) 282
GsuI CTGGAG 1 cut(s) 510
Hin1II CATG 2 cut(s) 205, 352
HincII GTYRAC 1 cut(s) 163
HindII GTYRAC 1 cut(s) 163
HindIII AAGCTT 1 cut(s) 252
Hpy166II GTNNAC 3 cut(s) 130, 163, 439
Hpy188III TCNNGA 1 cut(s) 489
Hpy8I GTNNAC 3 cut(s) 130, 163, 439
HpyAV CCTTC 1 cut(s) 300
HpyCH4III ACNGT 2 cut(s) 127, 376
HpyCH4IV ACGT 1 cut(s) 9
HpyCH4V TGCA 3 cut(s) 123, 237, 461
HpySE526I ACGT 1 cut(s) 9
Hsp92II CATG 2 cut(s) 205, 352
Kzo9I GATC 1 cut(s) 205
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 7 cut(s) 33, 151, 300, 327, 390, 474, 485
MaeI CTAG 1 cut(s) 282
MaeII ACGT 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 383
MalI GATC 1 cut(s) 207
MboI GATC 1 cut(s) 205
MboII GAAGA 1 cut(s) 421
MflI RGATCY 1 cut(s) 205
MluCI AATT 3 cut(s) 133, 245, 369
MnlI CCTC 5 cut(s) 27, 233, 457, 517, 543
MseI TTAA 2 cut(s) 248, 515
MslI CAYNNNNRTG 3 cut(s) 89, 103, 114
MspR9I CCNGG 1 cut(s) 315
Mva1269I GAATGC 1 cut(s) 348
MvaI CCWGG 1 cut(s) 315
NdeI CATATG 1 cut(s) 537
NdeII GATC 1 cut(s) 205
NlaIII CATG 2 cut(s) 205, 352
NlaIV GGNNCC 2 cut(s) 355, 531
NmuCI GTSAC 1 cut(s) 383
PcsI WCGNNNNNNNCGW 1 cut(s) 168
PctI GAATGC 1 cut(s) 348
PflMI CCANNNNNTGG 1 cut(s) 202
PsiI TTATAA 1 cut(s) 554
Psp6I CCWGG 1 cut(s) 313
PspGI CCWGG 1 cut(s) 313
PspN4I GGNNCC 2 cut(s) 355, 531
PspPI GGNCC 1 cut(s) 541
PsuI RGATCY 1 cut(s) 205
RseI CAYNNNNRTG 3 cut(s) 89, 103, 114
SalI GTCGAC 1 cut(s) 161
SaqAI TTAA 2 cut(s) 248, 515
Sau3AI GATC 1 cut(s) 205
Sau96I GGNCC 1 cut(s) 541
ScrFI CCNGG 1 cut(s) 315
SetI ASST 6 cut(s) 12, 25, 256, 364, 480, 528
SfcI CTRYAG 1 cut(s) 274
SinI GGWCC 1 cut(s) 541
SmiMI CAYNNNNRTG 3 cut(s) 89, 103, 114
SpeI ACTAGT 1 cut(s) 281
Sse9I AATT 3 cut(s) 133, 245, 369
SspMI CTAG 1 cut(s) 282
StyD4I CCNGG 1 cut(s) 313
StyI CCWWGG 1 cut(s) 211
TaaI ACNGT 2 cut(s) 127, 376
TaiI ACGT 1 cut(s) 12
TaqI TCGA 1 cut(s) 162
TasI AATT 3 cut(s) 133, 245, 369
Tru1I TTAA 2 cut(s) 248, 515
Tru9I TTAA 2 cut(s) 248, 515
TscAI CASTG 2 cut(s) 130, 145
TseFI GTSAC 1 cut(s) 383
Tsp45I GTSAC 1 cut(s) 383
TspDTI ATGAA 3 cut(s) 51, 107, 462
TspRI CASTG 2 cut(s) 130, 145
Van91I CCANNNNNTGG 1 cut(s) 202
VpaK11BI GGWCC 1 cut(s) 541
XmiI GTMKAC 2 cut(s) 162, 438
XspI CTAG 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.