Rmu_sc0001250.1_g000038

LURP-one-related

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001250.1
OG0011668
Physical Location & Seq
Reverse (-)
158800 .. 161502
2703 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001250.1_g000038.1.cds

Sequence Viewer

Length: 786 bp
atggcaaaggtatgtcgacctggtgcagctccccaagttccttctgtcactccgtacatgagctcaaagagagaaacatataccatttggatgaagtcacttgtatgcaatacaaatggttgcaccgtctataattccaatggtgagattgtctaccgagttgacaactatgacaaaaggtgcagcaatgaagtccatctcatgaatctgcaagggaaacttctttacaccatacgtaaaaagaagctacaagctttcgaacgatgggatggctataaatggagtggatcttgtaaatttgaaaaagaggagaagccttggtttcatgtgaaaagatatagcagaatgcttatgggaagcttagcttgtcaaattacagtagggtttgaaaagtattggatagtgagattaacaggcaagactactgcagggtttagaatagtggacattgatggagggattgctgcagaggcaaagaagaagctatcatcttctgggatagttctgggagaagatgtattaaccttggaggtggagactcatatggaccattcacttataatggctattgtaactgcctatggattaatttgtcgcaaaataggaaaatgtgagaaagagtctggctttaagtcgaaggaggaggagttggatgtgattgaggaggccattacagagaagctattggagtttgaagaaggtaagacccaattggtggtggtggtggtggtggtagatgatccaatggtggatgtggtggtggatgaggagggattttgctcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LOR

Protein Analysis

261

Amino Acids

29.53

Weight (kDa)

6.47

Isoelectric Point (pI)

29.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011668)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G63410 AT1G63410 AT1G63410
fragaria_vesca FvH4_5g02030 FvH4_5g02030
malus_domestica MD06G1080200.v1.1 MD14G1101600.v1.1
prunus_persica Prupe.5G096800_v2.0.a1
pyrus_communis pycom06g07720
rosa_chinensis RchiOBHm_Chr7g0198311
rosa_laevigata RLG00000003877
rosa_multiflora Rmu_sc0001250.1_g000038
rosa_roxburghii Rroxscaffold_3G00257850
rosa_rugosa Rorug07G0046800
rosa_samantha Rh7AG170300 Rh7BG173400 Rh7CG181000 Rh7DG172500
rosa_wichuraiana Rw7G014910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 560
AccB7I CCANNNNNTGG 1 cut(s) 715
AccI GTMKAC 2 cut(s) 16, 153
AclWI GGATC 2 cut(s) 295, 734
AcsI RAATTY 1 cut(s) 296
AfaI GTAC 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 715
AgsI TTSAA 3 cut(s) 302, 389, 695
AjnI CCWGG 1 cut(s) 19
AluBI AGCT 8 cut(s) 29, 63, 247, 254, 360, 365, 484, 682
AluI AGCT 8 cut(s) 29, 63, 247, 254, 360, 365, 484, 682
Alw21I GWGCWC 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 530
AlwI GGATC 2 cut(s) 295, 734
AoxI GGCC 1 cut(s) 666
ApeKI GCWGC 3 cut(s) 26, 183, 464
ApoI RAATTY 1 cut(s) 296
AseI ATTAAT 1 cut(s) 587
AspS9I GGNCC 1 cut(s) 547
AsuHPI GGTGA 1 cut(s) 155
AsuII TTCGAA 1 cut(s) 258
AvaII GGWCC 1 cut(s) 547
BanII GRGCYC 1 cut(s) 65
Bbv12I GWGCWC 1 cut(s) 65
BbvI GCAGC 3 cut(s) 38, 195, 451
BccI CCATC 4 cut(s) 204, 258, 263, 446
BciT130I CCWGG 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 530
BfmI CTRYAG 2 cut(s) 426, 465
BisI GCNGC 3 cut(s) 27, 184, 465
BlpI GCTNAGC 1 cut(s) 361
BlsI GCNGC 3 cut(s) 28, 185, 466
Bme1390I CCNGG 1 cut(s) 21
Bme18I GGWCC 1 cut(s) 547
BmgT120I GGNCC 1 cut(s) 547
BmrFI CCNGG 1 cut(s) 21
Bpu1102I GCTNAGC 1 cut(s) 361
Bpu14I TTCGAA 1 cut(s) 258
BsaAI YACGTR 1 cut(s) 236
BsaJI CCNNGG 2 cut(s) 317, 525
BsaXI ACNNNNNCTCC 4 cut(s) 501, 531, 632, 662
Bsc4I CCNNNNNNNGG 1 cut(s) 715
Bse3DI GCAATG 1 cut(s) 193
BseBI CCWGG 1 cut(s) 21
BseDI CCNNGG 2 cut(s) 317, 525
BseGI GGATG 5 cut(s) 96, 274, 658, 757, 769
BseLI CCNNNNNNNGG 1 cut(s) 715
BseMI GCAATG 1 cut(s) 193
BseRI GAGGAG 5 cut(s) 323, 656, 659, 677, 782
BseXI GCAGC 3 cut(s) 38, 195, 451
BsgI GTGCAG 2 cut(s) 45, 202
BshFI GGCC 1 cut(s) 668
BsiHKAI GWGCWC 1 cut(s) 65
BslI CCNNNNNNNGG 1 cut(s) 715
BsmAI GTCTC 1 cut(s) 530
BsmI GAATGC 1 cut(s) 351
BsnI GGCC 1 cut(s) 668
Bsp119I TTCGAA 1 cut(s) 258
Bsp1286I GDGCHC 1 cut(s) 65
Bsp143I GATC 2 cut(s) 287, 739
Bsp1720I GCTNAGC 1 cut(s) 361
BspANI GGCC 1 cut(s) 668
BspHI TCATGA 1 cut(s) 201
BspMAI CTGCAG 2 cut(s) 430, 469
BspPI GGATC 2 cut(s) 295, 734
BspT104I TTCGAA 1 cut(s) 258
BsrDI GCAATG 1 cut(s) 193
BssECI CCNNGG 2 cut(s) 317, 525
BssMI GATC 2 cut(s) 287, 739
BssT1I CCWWGG 2 cut(s) 317, 525
Bst2UI CCWGG 1 cut(s) 21
Bst4CI ACNGT 2 cut(s) 127, 379
BstBAI YACGTR 1 cut(s) 236
BstBI TTCGAA 1 cut(s) 258
BstDEI CTNAG 1 cut(s) 361
BstF5I GGATG 5 cut(s) 96, 274, 658, 757, 769
BstKTI GATC 2 cut(s) 290, 742
BstMAI GTCTC 1 cut(s) 530
BstMBI GATC 2 cut(s) 287, 739
BstMWI GCNNNNNNNGC 1 cut(s) 470
BstNI CCWGG 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 19
BstSFI CTRYAG 2 cut(s) 426, 465
BstSNI TACGTA 1 cut(s) 236
BstV1I GCAGC 3 cut(s) 38, 195, 451
BstX2I RGATCY 1 cut(s) 287
BstYI RGATCY 1 cut(s) 287
BsuRI GGCC 1 cut(s) 668
BtsCI GGATG 5 cut(s) 96, 274, 658, 757, 769
CciI TCATGA 1 cut(s) 201
Cfr13I GGNCC 1 cut(s) 547
CsiI ACCWGGT 1 cut(s) 19
Csp6I GTAC 1 cut(s) 55
CviAII CATG 3 cut(s) 58, 202, 326
CviQI GTAC 1 cut(s) 55
DdeI CTNAG 1 cut(s) 361
DpnI GATC 2 cut(s) 289, 741
DpnII GATC 2 cut(s) 287, 739
Ecl136II GAGCTC 1 cut(s) 63
Eco105I TACGTA 1 cut(s) 236
Eco130I CCWWGG 2 cut(s) 317, 525
Eco24I GRGCYC 1 cut(s) 65
Eco47I GGWCC 1 cut(s) 547
Eco53kI GAGCTC 1 cut(s) 63
EcoICRI GAGCTC 1 cut(s) 63
EcoRII CCWGG 1 cut(s) 19
EcoT14I CCWWGG 2 cut(s) 317, 525
EcoT38I GRGCYC 1 cut(s) 65
ErhI CCWWGG 2 cut(s) 317, 525
FaeI CATG 3 cut(s) 61, 205, 329
FalI AAGNNNNNCTT 4 cut(s) 204, 236, 349, 381
FatI CATG 3 cut(s) 57, 201, 325
FauNDI CATATG 1 cut(s) 543
FblI GTMKAC 2 cut(s) 16, 153
Fnu4HI GCNGC 3 cut(s) 27, 184, 465
FokI GGATG 5 cut(s) 103, 281, 665, 764, 776
FriOI GRGCYC 1 cut(s) 65
Fsp4HI GCNGC 3 cut(s) 27, 184, 465
GluI GCNGC 3 cut(s) 27, 184, 465
HaeIII GGCC 1 cut(s) 668
Hin1II CATG 3 cut(s) 61, 205, 329
HincII GTYRAC 2 cut(s) 17, 163
HindII GTYRAC 2 cut(s) 17, 163
HindIII AAGCTT 2 cut(s) 252, 358
HinfI GANTC 3 cut(s) 205, 538, 620
HphI GGTGA 1 cut(s) 155
Hpy166II GTNNAC 4 cut(s) 17, 154, 163, 445
Hpy188III TCNNGA 2 cut(s) 202, 783
Hpy8I GTNNAC 4 cut(s) 17, 154, 163, 445
HpyAV CCTTC 3 cut(s) 51, 631, 692
HpyCH4III ACNGT 2 cut(s) 127, 379
HpyCH4IV ACGT 1 cut(s) 235
HpyCH4V TGCA 7 cut(s) 26, 108, 123, 183, 211, 428, 467
HpyF10VI GCNNNNNNNGC 1 cut(s) 470
HpyF3I CTNAG 1 cut(s) 361
HpySE526I ACGT 1 cut(s) 235
Hsp92II CATG 3 cut(s) 61, 205, 329
Kzo9I GATC 2 cut(s) 287, 739
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 7 cut(s) 6, 33, 399, 414, 480, 491, 609
Lsp1109I GCAGC 3 cut(s) 38, 195, 451
MabI ACCWGGT 1 cut(s) 19
MaeII ACGT 1 cut(s) 235
MaeIII GTNAC 3 cut(s) 46, 96, 571
MalI GATC 2 cut(s) 289, 741
MboI GATC 2 cut(s) 287, 739
MboII GAAGA 4 cut(s) 483, 490, 524, 707
MfeI CAATTG 1 cut(s) 710
MflI RGATCY 1 cut(s) 287
MhlI GDGCHC 1 cut(s) 65
MluCI AATT 5 cut(s) 133, 296, 372, 588, 710
MlyI GAGTC 2 cut(s) 532, 629
MmeI TCCRAC 1 cut(s) 630
MseI TTAA 4 cut(s) 410, 521, 587, 630
MslI CAYNNNNRTG 2 cut(s) 89, 103
MspR9I CCNGG 1 cut(s) 21
MunI CAATTG 1 cut(s) 710
Mva1269I GAATGC 1 cut(s) 351
MvaI CCWGG 1 cut(s) 21
MwoI GCNNNNNNNGC 1 cut(s) 470
NdeI CATATG 1 cut(s) 543
NdeII GATC 2 cut(s) 287, 739
NlaIII CATG 3 cut(s) 61, 205, 329
NmuCI GTSAC 2 cut(s) 46, 96
NspV TTCGAA 1 cut(s) 258
PagI TCATGA 1 cut(s) 201
PctI GAATGC 1 cut(s) 351
PfeI GAWTC 1 cut(s) 205
PflMI CCANNNNNTGG 1 cut(s) 715
PkrI GCNGC 3 cut(s) 28, 185, 466
PleI GAGTC 2 cut(s) 532, 628
PpsI GAGTC 2 cut(s) 532, 628
Ppu21I YACGTR 1 cut(s) 236
PshBI ATTAAT 1 cut(s) 587
PsiI TTATAA 1 cut(s) 560
Psp124BI GAGCTC 1 cut(s) 65
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
PspPI GGNCC 1 cut(s) 547
PstI CTGCAG 2 cut(s) 430, 469
PsuI RGATCY 1 cut(s) 287
RsaI GTAC 1 cut(s) 56
RsaNI GTAC 1 cut(s) 55
RseI CAYNNNNRTG 2 cut(s) 89, 103
SacI GAGCTC 1 cut(s) 65
SalI GTCGAC 1 cut(s) 15
SaqAI TTAA 4 cut(s) 410, 521, 587, 630
SatI GCNGC 3 cut(s) 27, 184, 465
Sau3AI GATC 2 cut(s) 287, 739
Sau96I GGNCC 1 cut(s) 547
SchI GAGTC 2 cut(s) 532, 629
ScrFI CCNGG 1 cut(s) 21
SduI GDGCHC 1 cut(s) 65
SexAI ACCWGGT 1 cut(s) 19
SfcI CTRYAG 2 cut(s) 426, 465
SfuI TTCGAA 1 cut(s) 258
SinI GGWCC 1 cut(s) 547
SmiMI CAYNNNNRTG 2 cut(s) 89, 103
SnaBI TACGTA 1 cut(s) 236
Sse9I AATT 5 cut(s) 133, 296, 372, 588, 710
SstI GAGCTC 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 19
StyI CCWWGG 2 cut(s) 317, 525
TaaI ACNGT 2 cut(s) 127, 379
TaiI ACGT 1 cut(s) 238
TaqI TCGA 3 cut(s) 16, 258, 635
TasI AATT 5 cut(s) 133, 296, 372, 588, 710
TfiI GAWTC 1 cut(s) 205
Tru1I TTAA 4 cut(s) 410, 521, 587, 630
Tru9I TTAA 4 cut(s) 410, 521, 587, 630
TseFI GTSAC 2 cut(s) 46, 96
TseI GCWGC 3 cut(s) 26, 183, 464
Tsp45I GTSAC 2 cut(s) 46, 96
TspDTI ATGAA 4 cut(s) 107, 204, 218, 314
TspGWI ACGGA 1 cut(s) 42
Van91I CCANNNNNTGG 1 cut(s) 715
VpaK11BI GGWCC 1 cut(s) 547
VspI ATTAAT 1 cut(s) 587
XapI RAATTY 1 cut(s) 296
XmiI GTMKAC 2 cut(s) 16, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.