MD15G1231700.v1.1

DNA binding

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
18940617 .. 18943051
2435 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1231700.v1.1.491

Sequence Viewer

Length: 138 bp
ATGAATGCTTACAACAAGCGCATAGCTGAGGGAGGTAACGGAGCGGATGATGAAGAGTCCGATAAGTCCAAGTCTGAGGTGCAAAACGAGGATGAAGATGATGACGAGAGTGGAGAGGAAGAAGATGATGACGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

46

Amino Acids

5.01

Weight (kDa)

4.05

Isoelectric Point (pI)

59.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012733)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 44
AciI CCGC 1 cut(s) 44
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
AspLEI GCGC 1 cut(s) 21
BbvCI CCTCAGC 1 cut(s) 27
Bpu10I CCTNAGC 1 cut(s) 27
BseGI GGATG 2 cut(s) 52, 97
BseMII CTCAG 2 cut(s) 18, 66
BsmI GAATGC 1 cut(s) 10
BspACI CCGC 1 cut(s) 44
BspCNI CTCAG 2 cut(s) 19, 67
BsrBI CCGCTC 1 cut(s) 44
Bst6I CTCTTC 1 cut(s) 48
BstDEI CTNAG 2 cut(s) 27, 75
BstF5I GGATG 2 cut(s) 52, 97
BstHHI GCGC 1 cut(s) 21
BtsCI GGATG 2 cut(s) 52, 97
CfoI GCGC 1 cut(s) 21
CviJI RGCY 1 cut(s) 26
CviKI_1 RGCY 1 cut(s) 26
DdeI CTNAG 2 cut(s) 27, 75
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
FaiI YATR 1 cut(s) 23
FokI GGATG 2 cut(s) 59, 104
GlaI GCGC 1 cut(s) 20
HhaI GCGC 1 cut(s) 21
Hin6I GCGC 1 cut(s) 19
HinP1I GCGC 1 cut(s) 19
HinfI GANTC 1 cut(s) 56
Hpy188I TCNGA 2 cut(s) 61, 76
HpyCH4V TGCA 1 cut(s) 82
HpyF3I CTNAG 2 cut(s) 27, 75
HspAI GCGC 1 cut(s) 19
LmnI GCTCC 1 cut(s) 41
MaeIII GTNAC 1 cut(s) 35
MbiI CCGCTC 1 cut(s) 44
MboII GAAGA 4 cut(s) 65, 107, 131, 134
MlyI GAGTC 1 cut(s) 65
MnlI CCTC 5 cut(s) 22, 26, 70, 82, 109
Mva1269I GAATGC 1 cut(s) 10
PctI GAATGC 1 cut(s) 10
PleI GAGTC 1 cut(s) 64
PpsI GAGTC 1 cut(s) 64
SchI GAGTC 1 cut(s) 65
SetI ASST 3 cut(s) 28, 37, 81
SgeI CNNG 4 cut(s) 28, 82, 100, 118
SsiI CCGC 1 cut(s) 44
TspDTI ATGAA 3 cut(s) 17, 66, 108
TspGWI ACGGA 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.