MD15G1442500.v1.1

Mitotic checkpoint family protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
54279029 .. 54280322
1294 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1442500.v1.1.491

Sequence Viewer

Length: 168 bp
ATGAAGAAGTTGGAGGATGAATTGACTTCTTGGAAGTTGATCATTGAAGACATTCCAGGCGTGTCATGTTCTGAGGATTTACCAGTTAAATTCGCATCATTACAAAAGTATGTGAATAGCTCATTTCAGTCCTTTGAACCAGCATTGTTAGATCATTTAGACGAATGA

Protein Analysis

56

Amino Acids

6.29

Weight (kDa)

4.46

Isoelectric Point (pI)

65.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 89
AgsI TTSAA 2 cut(s) 47, 137
AjnI CCWGG 1 cut(s) 55
AluBI AGCT 1 cut(s) 120
AluI AGCT 1 cut(s) 120
ApoI RAATTY 1 cut(s) 89
Asp700I GAANNNNTTC 1 cut(s) 51
BbsI GAAGAC 1 cut(s) 54
BciT130I CCWGG 1 cut(s) 57
BclI TGATCA 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 57
BmrFI CCNGG 1 cut(s) 57
BmsI GCATC 1 cut(s) 104
BpiI GAAGAC 1 cut(s) 54
Bse1I ACTGG 1 cut(s) 83
BseBI CCWGG 1 cut(s) 57
BseGI GGATG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 63
BseNI ACTGG 1 cut(s) 83
Bsp143I GATC 2 cut(s) 39, 151
BspCNI CTCAG 1 cut(s) 64
BsrI ACTGG 1 cut(s) 83
BssMI GATC 2 cut(s) 39, 151
Bst2UI CCWGG 1 cut(s) 57
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 2 cut(s) 42, 154
BstMBI GATC 2 cut(s) 39, 151
BstNI CCWGG 1 cut(s) 57
BstSCI CCNGG 1 cut(s) 55
BstV2I GAAGAC 1 cut(s) 54
BtsCI GGATG 1 cut(s) 22
CviAII CATG 1 cut(s) 66
CviJI RGCY 1 cut(s) 120
CviKI_1 RGCY 1 cut(s) 120
DdeI CTNAG 1 cut(s) 72
DpnI GATC 2 cut(s) 41, 153
DpnII GATC 2 cut(s) 39, 151
EcoRII CCWGG 1 cut(s) 55
FaeI CATG 1 cut(s) 69
FaiI YATR 2 cut(s) 67, 111
FatI CATG 1 cut(s) 65
FbaI TGATCA 1 cut(s) 39
FokI GGATG 1 cut(s) 29
FspEI CC 7 cut(s) 16, 42, 59, 69, 96, 145, 153
Hin1II CATG 1 cut(s) 69
Hpy188I TCNGA 1 cut(s) 73
HpyF3I CTNAG 1 cut(s) 72
Hsp92II CATG 1 cut(s) 69
Ksp22I TGATCA 1 cut(s) 39
Kzo9I GATC 2 cut(s) 39, 151
LpnPI CCDG 4 cut(s) 42, 69, 96, 153
LweI GCATC 1 cut(s) 104
MalI GATC 2 cut(s) 41, 153
MboI GATC 2 cut(s) 39, 151
MboII GAAGA 2 cut(s) 16, 59
MluCI AATT 2 cut(s) 20, 89
MnlI CCTC 2 cut(s) 7, 67
MroXI GAANNNNTTC 1 cut(s) 51
MseI TTAA 1 cut(s) 87
MspR9I CCNGG 1 cut(s) 57
MvaI CCWGG 1 cut(s) 57
NdeII GATC 2 cut(s) 39, 151
NlaIII CATG 1 cut(s) 69
PdmI GAANNNNTTC 1 cut(s) 51
Psp6I CCWGG 1 cut(s) 55
PspGI CCWGG 1 cut(s) 55
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 2 cut(s) 39, 151
ScrFI CCNGG 1 cut(s) 57
SetI ASST 1 cut(s) 122
SfaNI GCATC 1 cut(s) 104
SgeI CNNG 7 cut(s) 42, 68, 69, 73, 78, 95, 152
Sse9I AATT 2 cut(s) 20, 89
StyD4I CCNGG 1 cut(s) 55
TasI AATT 2 cut(s) 20, 89
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TspDTI ATGAA 2 cut(s) 17, 33
XapI RAATTY 1 cut(s) 89
XmnI GAANNNNTTC 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.