Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007335.1

Orthogroup ID

OG0006107

Physical Location & Seq

Genomic Coordinates Reverse (-)

46515 .. 47590

Gene Structure 1076 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007335.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

atggatgaacaccagcgaccgaatggtatccctgttacacgttttaccctccaatctatatatgctcaaagcgataatgagaagcttgaatttgaatacgaatcagggactacaaacattttggcaaatgattatacctctcagcgtgagatatctcaacaggttgagatatttattcggaaaatgaattcaatcccagctttcactgccaatttaacagtggagtcgttcaaccggcgaaccctgagctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000070 GO:0000075 GO:0000278 GO:0000280 GO:0000775 GO:0000776 GO:0000819 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005635 GO:0005694 GO:0005819 GO:0005856 GO:0006996 GO:0007049 GO:0007059 GO:0007080 GO:0007088 GO:0007093 GO:0007094 GO:0007346 GO:0008150 GO:0008608 GO:0009987 GO:0010564 GO:0010639 GO:0010948 GO:0010965 GO:0012505 GO:0015630 GO:0016043 GO:0022402 GO:0030071 GO:0031577 GO:0031967 GO:0031975 GO:0032991 GO:0033043 GO:0033044 GO:0033045 GO:0033046 GO:0033047 GO:0033048 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044430 GO:0044446 GO:0044464 GO:0045786 GO:0045839 GO:0045841 GO:0045930 GO:0048285 GO:0048519 GO:0048523 GO:0050000 GO:0050789 GO:0050794 GO:0051128 GO:0051129 GO:0051179 GO:0051234 GO:0051276 GO:0051303 GO:0051310 GO:0051315 GO:0051640 GO:0051641 GO:0051649 GO:0051656 GO:0051726 GO:0051783 GO:0051784 GO:0051983 GO:0051985 GO:0065007 GO:0071173 GO:0071174 GO:0071840 GO:0072686 GO:0098687 GO:0098813 GO:0140014 GO:1901987 GO:1901988 GO:1901990 GO:1901991 GO:1902099 GO:1902100 GO:1903047 GO:1905818 GO:1905819 GO:2000816 GO:2001251

KEGG Pathways

Metabolic & Signaling

ko04110 ko04914 ko05203 map04110 map04914 map05203

Pfam Domains

Protein Families

DUF4094 Galactosyl_T MAD

Protein Analysis

83

Amino Acids

9.63

Weight (kDa)

5.0

Isoelectric Point (pI)

56.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006107)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G49880
fragaria_vesca	FvH4_5g27851 FvH4_5g27851 FvH4_5g27851 FvH4_5g27851 FvH4_5g27851 FvH4_5g27851 FvH4_5g27851
malus_domestica	MD08G1248100.v1.1 MD15G1442500.v1.1 MD15G1442900.v1.1
prunus_persica	Prupe.1G585300_v2.0.a1 Prupe.1G585300_v2.0.a1
pyrus_communis	pycom08g21490 pycom15g39070
rosa_chinensis	RchiOBHm_Chr7g0219751
rosa_laevigata	RLG00000002272
rosa_multiflora	Rmu_co8270887.1_g000001 Rmu_sc0007335.1_g000005
rosa_roxburghii	Rroxscaffold_3G00239880
rosa_rugosa	Rorug07G0187600 Rorug07G0187700
rosa_samantha	Rh7AG331300 Rh7BG321100 Rh7CG348700 Rh7DG326800
rosa_wichuraiana	Rw7G027890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	89, 187
AflIII	ACRYGT	1 cut(s)	38
AgsI	TTSAA	4 cut(s)	89, 95, 192, 232
AluBI	AGCT	3 cut(s)	85, 200, 249
AluI	AGCT	3 cut(s)	85, 200, 249
ApoI	RAATTY	2 cut(s)	89, 187
BciVI	GTATCC	1 cut(s)	38
BfuI	GTATCC	1 cut(s)	38
Bpu10I	CCTNAGC	1 cut(s)	245
Bse118I	RCCGGY	1 cut(s)	234
BseGI	GGATG	1 cut(s)	10
BseMII	CTCAG	2 cut(s)	155, 236
BseYI	CCCAGC	1 cut(s)	196
Bsh1285I	CGRYCG	1 cut(s)	20
BsiEI	CGRYCG	1 cut(s)	20
BsiSI	CCGG	1 cut(s)	235
BslFI	GGGAC	1 cut(s)	121
BsmFI	GGGAC	1 cut(s)	121
BspCNI	CTCAG	2 cut(s)	154, 237
BsrFI	RCCGGY	1 cut(s)	234
BssAI	RCCGGY	1 cut(s)	234
Bst4CI	ACNGT	1 cut(s)	220
BstDEI	CTNAG	2 cut(s)	141, 245
BstF5I	GGATG	1 cut(s)	10
BstMCI	CGRYCG	1 cut(s)	20
BstMWI	GCNNNNNNNGC	1 cut(s)	206
BsuI	GTATCC	1 cut(s)	38
BtsCI	GGATG	1 cut(s)	10
BtsI	GCAGTG	1 cut(s)	204
BtsIMutI	CAGTG	2 cut(s)	204, 225
Cfr10I	RCCGGY	1 cut(s)	234
CviJI	RGCY	3 cut(s)	85, 200, 249
CviKI_1	RGCY	3 cut(s)	85, 200, 249
DdeI	CTNAG	2 cut(s)	141, 245
Eco32I	GATATC	1 cut(s)	153
EcoRI	GAATTC	1 cut(s)	187
EcoRV	GATATC	1 cut(s)	153
FaiI	YATR	4 cut(s)	59, 61, 63, 135
FaqI	GGGAC	1 cut(s)	121
FokI	GGATG	1 cut(s)	17
GsaI	CCCAGC	1 cut(s)	200
HapII	CCGG	1 cut(s)	235
HindIII	AAGCTT	1 cut(s)	83
HinfI	GANTC	2 cut(s)	101, 224
HpaII	CCGG	1 cut(s)	235
Hpy188I	TCNGA	1 cut(s)	180
HpyCH4III	ACNGT	1 cut(s)	220
HpyCH4IV	ACGT	1 cut(s)	40
HpyF10VI	GCNNNNNNNGC	1 cut(s)	206
HpyF3I	CTNAG	2 cut(s)	141, 245
HpySE526I	ACGT	1 cut(s)	40
LpnPI	CCDG	6 cut(s)	26, 45, 90, 146, 210, 248
MaeII	ACGT	1 cut(s)	40
MaeIII	GTNAC	1 cut(s)	34
MluCI	AATT	3 cut(s)	89, 187, 211
MlyI	GAGTC	1 cut(s)	233
MnlI	CCTC	2 cut(s)	59, 148
MseI	TTAA	1 cut(s)	215
MspI	CCGG	1 cut(s)	235
MwoI	GCNNNNNNNGC	1 cut(s)	206
PfeI	GAWTC	1 cut(s)	101
PleI	GAGTC	1 cut(s)	232
PpsI	GAGTC	1 cut(s)	232
PspFI	CCCAGC	1 cut(s)	196
SaqAI	TTAA	1 cut(s)	215
SchI	GAGTC	1 cut(s)	233
SetI	ASST	6 cut(s)	43, 87, 140, 165, 202, 251
SgeI	CNNG	9 cut(s)	25, 44, 51, 98, 117, 158, 173, 209, 247
Sse9I	AATT	3 cut(s)	89, 187, 211
TaaI	ACNGT	1 cut(s)	220
TaiI	ACGT	1 cut(s)	43
TaqII	GACCGA	1 cut(s)	34
TasI	AATT	3 cut(s)	89, 187, 211
TfiI	GAWTC	1 cut(s)	101
Tru1I	TTAA	1 cut(s)	215
Tru9I	TTAA	1 cut(s)	215
TscAI	CASTG	2 cut(s)	211, 225
TspDTI	ATGAA	2 cut(s)	21, 200
TspRI	CASTG	2 cut(s)	211, 225
XapI	RAATTY	2 cut(s)	89, 187
XcmI	CCANNNNNNNNNTGG	2 cut(s)	20, 217

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.