MD16G1042600.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Forward (+)
3012921 .. 3013166
246 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1042600.v1.1.491

Sequence Viewer

Length: 246 bp
ATGGCTGGGGATGAGAATTACTGGGGGAATTTGGGTGGTGGTGTTGCGGTGGATGAGCTATTGTCGTGGGGGTCCGTTTGGGTGCCACTTTGGGATGTGGAGTTTATGGAAGAATCGCATTACGGATTGTTCAGTGATGTGATTTGGGACGCTGACATTTGGGGATTGAGAACCACAAAAAGATCCCAACTCCGTGAAAAAAGACGGAGAGAAGATTTGTATTTACATTGTTCAGTTTATGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.51

Weight (kDa)

4.66

Isoelectric Point (pI)

56.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015056)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G25422 AT1G68500
fragaria_vesca FvH4_4g27340
malus_domestica MD13G1041700.v1.1 MD16G1042600.v1.1
prunus_persica Prupe.1G311500_v2.0.a1
pyrus_communis pycom13g03610
rosa_chinensis RchiOBHm_Chr4g0435141
rosa_laevigata RLG00000006616
rosa_multiflora Rmu_ssc0000339.1_g000038
rosa_roxburghii Rroxscaffold_5G00376360
rosa_rugosa Rorug04G0282600
rosa_samantha Rh4BG346400 Rh4CG360900 Rh4DG340800
rosa_wichuraiana Rw4G029490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 82
AciI CCGC 1 cut(s) 47
AclWI GGATC 1 cut(s) 177
AcsI RAATTY 1 cut(s) 28
AluBI AGCT 1 cut(s) 58
AluI AGCT 1 cut(s) 58
AlwI GGATC 1 cut(s) 177
ApoI RAATTY 1 cut(s) 28
AspS9I GGNCC 1 cut(s) 72
AvaII GGWCC 1 cut(s) 72
BanI GGYRCC 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 72
BmgT120I GGNCC 1 cut(s) 72
BmiI GGNNCC 2 cut(s) 73, 84
BmrI ACTGGG 1 cut(s) 31
BmuI ACTGGG 1 cut(s) 31
Bse1I ACTGG 1 cut(s) 26
BseGI GGATG 3 cut(s) 16, 58, 100
BseNI ACTGG 1 cut(s) 26
BseYI CCCAGC 1 cut(s) 5
BshNI GGYRCC 1 cut(s) 82
BslFI GGGAC 1 cut(s) 161
BsmFI GGGAC 1 cut(s) 161
Bsp143I GATC 1 cut(s) 182
BspACI CCGC 1 cut(s) 47
BspLI GGNNCC 2 cut(s) 73, 84
BspPI GGATC 1 cut(s) 177
BspT107I GGYRCC 1 cut(s) 82
BsrI ACTGG 1 cut(s) 26
BssMI GATC 1 cut(s) 182
BstF5I GGATG 3 cut(s) 16, 58, 100
BstKTI GATC 1 cut(s) 185
BstMBI GATC 1 cut(s) 182
BstX2I RGATCY 1 cut(s) 182
BstYI RGATCY 1 cut(s) 182
BtsCI GGATG 3 cut(s) 16, 58, 100
BtsIMutI CAGTG 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 72
CseI GACGC 1 cut(s) 158
CviJI RGCY 2 cut(s) 5, 58
CviKI_1 RGCY 2 cut(s) 5, 58
DpnI GATC 1 cut(s) 184
DpnII GATC 1 cut(s) 182
Eco47I GGWCC 1 cut(s) 72
FaiI YATR 3 cut(s) 107, 240, 244
FaqI GGGAC 1 cut(s) 161
FokI GGATG 3 cut(s) 23, 65, 107
GsaI CCCAGC 1 cut(s) 9
HgaI GACGC 1 cut(s) 158
HinfI GANTC 1 cut(s) 113
Kzo9I GATC 1 cut(s) 182
LpnPI CCDG 1 cut(s) 7
MalI GATC 1 cut(s) 184
MboI GATC 1 cut(s) 182
MboII GAAGA 2 cut(s) 122, 224
MflI RGATCY 1 cut(s) 182
MluCI AATT 2 cut(s) 16, 28
NdeII GATC 1 cut(s) 182
NlaIV GGNNCC 2 cut(s) 73, 84
PfeI GAWTC 1 cut(s) 113
PspFI CCCAGC 1 cut(s) 5
PspN4I GGNNCC 2 cut(s) 73, 84
PspPI GGNCC 1 cut(s) 72
PsuI RGATCY 1 cut(s) 182
Sau3AI GATC 1 cut(s) 182
Sau96I GGNCC 1 cut(s) 72
SetI ASST 1 cut(s) 60
SgeI CNNG 4 cut(s) 18, 34, 78, 206
SinI GGWCC 1 cut(s) 72
Sse9I AATT 2 cut(s) 16, 28
SsiI CCGC 1 cut(s) 47
TasI AATT 2 cut(s) 16, 28
TfiI GAWTC 1 cut(s) 113
TscAI CASTG 1 cut(s) 139
TspGWI ACGGA 4 cut(s) 64, 138, 182, 220
TspRI CASTG 1 cut(s) 139
VpaK11BI GGWCC 1 cut(s) 72
XapI RAATTY 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.