Prupe.1G377200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
34151789 .. 34152752
964 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G377200.1

Sequence Viewer

Length: 315 bp
ATGAGTGGGAGAACCTACGTTGTGATATTCTTCTTCTGGGCTGCCCTCACTCTCATCACCCCCACACTCATTTTCCTCTCAGAGACTTCAAAACCCTACTTGGATTCAAATGGTGAGAAAATTGAAGGAATCAAGGCTAGAAGAATGATAGAAATCATGAGATATCAAAGAAGCAGAGCAACCACAGAAGCACCTGCACCAACTCCAACTTCAGACCTGAAACCAGCTTTGGAGACTAGAGAAACCAATATTGGAAAGGGCTTGTTAGAATCTTTGAGATTGATGATCAAAAATACCAAGTTCAAGTTAACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.83

Weight (kDa)

9.91

Isoelectric Point (pI)

40.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014485)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 202
Acc36I ACCTGC 1 cut(s) 202
AcuI CTGAAG 1 cut(s) 195
AgsI TTSAA 4 cut(s) 90, 108, 125, 304
AjuI GAANNNNNNNTTGG 6 cut(s) 193, 212, 225, 234, 244, 266
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
Alw26I GTCTC 2 cut(s) 77, 227
ApeKI GCWGC 1 cut(s) 41
AsuHPI GGTGA 2 cut(s) 49, 125
BbvI GCAGC 1 cut(s) 28
BclI TGATCA 1 cut(s) 285
BcoDI GTCTC 2 cut(s) 77, 227
BfaI CTAG 2 cut(s) 138, 237
BfuAI ACCTGC 1 cut(s) 202
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
BsaBI GATNNNNATC 1 cut(s) 152
Bse8I GATNNNNATC 1 cut(s) 152
BseJI GATNNNNATC 1 cut(s) 152
BseMII CTCAG 1 cut(s) 93
BseXI GCAGC 1 cut(s) 28
BsgI GTGCAG 1 cut(s) 180
BsmAI GTCTC 2 cut(s) 77, 227
Bsp143I GATC 1 cut(s) 285
BspCNI CTCAG 1 cut(s) 92
BspHI TCATGA 1 cut(s) 156
BspMI ACCTGC 1 cut(s) 202
BssMI GATC 1 cut(s) 285
BstDEI CTNAG 1 cut(s) 79
BstKTI GATC 1 cut(s) 288
BstMAI GTCTC 2 cut(s) 77, 227
BstMBI GATC 1 cut(s) 285
BstV1I GCAGC 1 cut(s) 28
BveI ACCTGC 1 cut(s) 202
CciI TCATGA 1 cut(s) 156
CviAII CATG 1 cut(s) 157
CviJI RGCY 4 cut(s) 41, 137, 227, 261
CviKI_1 RGCY 4 cut(s) 41, 137, 227, 261
DdeI CTNAG 1 cut(s) 79
DpnI GATC 1 cut(s) 287
DpnII GATC 1 cut(s) 285
Eco32I GATATC 1 cut(s) 164
Eco57I CTGAAG 1 cut(s) 195
EcoRV GATATC 1 cut(s) 164
FaeI CATG 1 cut(s) 160
FaiI YATR 1 cut(s) 158
FatI CATG 1 cut(s) 156
FbaI TGATCA 1 cut(s) 285
Fnu4HI GCNGC 1 cut(s) 42
Fsp4HI GCNGC 1 cut(s) 42
FspBI CTAG 2 cut(s) 138, 237
GluI GCNGC 1 cut(s) 42
Hin1II CATG 1 cut(s) 160
HincII GTYRAC 1 cut(s) 309
HindII GTYRAC 1 cut(s) 309
HinfI GANTC 3 cut(s) 104, 129, 269
HpaI GTTAAC 1 cut(s) 309
HphI GGTGA 2 cut(s) 49, 125
Hpy166II GTNNAC 1 cut(s) 309
Hpy188I TCNGA 2 cut(s) 82, 214
Hpy188III TCNNGA 1 cut(s) 157
Hpy8I GTNNAC 1 cut(s) 309
HpyAV CCTTC 1 cut(s) 119
HpyCH4IV ACGT 2 cut(s) 18, 311
HpyCH4V TGCA 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 79
HpySE526I ACGT 2 cut(s) 18, 311
Hsp92II CATG 1 cut(s) 160
Ksp22I TGATCA 1 cut(s) 285
KspAI GTTAAC 1 cut(s) 309
Kzo9I GATC 1 cut(s) 285
LpnPI CCDG 4 cut(s) 22, 207, 230, 237
Lsp1109I GCAGC 1 cut(s) 28
MaeI CTAG 2 cut(s) 138, 237
MaeII ACGT 2 cut(s) 18, 311
MalI GATC 1 cut(s) 287
MboI GATC 1 cut(s) 285
MboII GAAGA 3 cut(s) 22, 25, 153
MluCI AATT 1 cut(s) 120
MmeI TCCRAC 1 cut(s) 230
MnlI CCTC 2 cut(s) 56, 86
MseI TTAA 1 cut(s) 308
NdeII GATC 1 cut(s) 285
NlaIII CATG 1 cut(s) 160
PagI TCATGA 1 cut(s) 156
PaqCI CACCTGC 1 cut(s) 202
PfeI GAWTC 3 cut(s) 104, 129, 269
PkrI GCNGC 1 cut(s) 43
SaqAI TTAA 1 cut(s) 308
SatI GCNGC 1 cut(s) 42
Sau3AI GATC 1 cut(s) 285
SetI ASST 6 cut(s) 17, 21, 196, 219, 229, 314
Sse9I AATT 1 cut(s) 120
SspI AATATT 1 cut(s) 250
SspMI CTAG 2 cut(s) 138, 237
TaiI ACGT 2 cut(s) 21, 314
TasI AATT 1 cut(s) 120
TfiI GAWTC 3 cut(s) 104, 129, 269
Tru1I TTAA 1 cut(s) 308
Tru9I TTAA 1 cut(s) 308
TseI GCWGC 1 cut(s) 41
XspI CTAG 2 cut(s) 138, 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.