Prupe.1G516300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
42474189 .. 42475587
1399 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G516300.1

Sequence Viewer

Length: 693 bp
ATGGTTTCTTTTCAAGCTCATCCCCTTTCTCCAAACCAGAAGAAGGCAATCCCAGAGTCTGAGAATTCATCCAAGAAAAGAAAGTGGGATGATGAGCCATATGATGATCATGATCATGATCAAGTCGAACAAATTTTCGAAAAGCGTTGGAAACCACAAACCAGAGCCAAATCCTTGTTTGATATTGAGCTTCACCAAGAAACTCCATTGCCTTTGGAGTGGCAAAGATGCCTTGATATTCAGTCAGGGCAGATACACTTTTACAATACAAGAACACACATGAAGACTTCTAGGGACCCAAGGAGGAGCCCTGAGCCCCCAAGTCCAGCTCCTCACATGAGCTTAGACCTTGAGCTCAACTTGAGATCCTGTGAGTCAATGATCAGGAAAGCCAATATTTCAGATCACAGCAGTGAAAACTCCAGGCCTAATTCAGACATTTCCCTTCACAATTTCCATGATCTTTTCATGGAACCCAGCAGACCAACAAAGAGCAAAAACCCATCAAGGCTGGGGCTCCAAATTGATCATCTTCATCACCAAGAGATGGTAGCCACTGTGTGCATGAAGTGCCACATGTTGGTTATGCTGTGCAGGTCTTCACCTGCATGCCCAAATTGCAAGTACATGCACCCACCTGATCAAACCCCACCAACCCTTTTCAAGCCAAGGTGTAGTAGCTTCATGTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

231

Amino Acids

26.82

Weight (kDa)

7.67

Isoelectric Point (pI)

79.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012040)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 613
Acc36I ACCTGC 2 cut(s) 585, 613
AccB7I CCANNNNNTGG 2 cut(s) 547, 580
AclWI GGATC 1 cut(s) 360
AcsI RAATTY 2 cut(s) 64, 132
AdeI CACNNNGTG 1 cut(s) 561
AfaI GTAC 1 cut(s) 626
AfiI CCNNNNNNNGG 3 cut(s) 43, 547, 580
AflIII ACRYGT 1 cut(s) 576
AgsI TTSAA 2 cut(s) 14, 664
AjnI CCWGG 1 cut(s) 422
AleI CACNNNNGTG 1 cut(s) 411
AluBI AGCT 6 cut(s) 17, 190, 329, 342, 355, 681
AluI AGCT 6 cut(s) 17, 190, 329, 342, 355, 681
Alw21I GWGCWC 1 cut(s) 357
AlwI GGATC 1 cut(s) 360
AlwNI CAGNNNCTG 1 cut(s) 59
AoxI GGCC 1 cut(s) 425
ApoI RAATTY 2 cut(s) 64, 132
AspS9I GGNCC 1 cut(s) 295
AsuHPI GGTGA 3 cut(s) 185, 530, 594
AsuII TTCGAA 1 cut(s) 138
AvaII GGWCC 1 cut(s) 295
BanII GRGCYC 4 cut(s) 311, 318, 357, 519
BbsI GAAGAC 2 cut(s) 290, 591
Bbv12I GWGCWC 1 cut(s) 357
BccI CCATC 2 cut(s) 511, 541
BciT130I CCWGG 1 cut(s) 424
BclI TGATCA 6 cut(s) 106, 112, 118, 381, 526, 640
BfaI CTAG 1 cut(s) 291
BfuAI ACCTGC 2 cut(s) 585, 613
Bme1390I CCNGG 1 cut(s) 424
Bme18I GGWCC 1 cut(s) 295
BmgT120I GGNCC 1 cut(s) 295
BmiI GGNNCC 5 cut(s) 296, 297, 308, 474, 518
BmrFI CCNGG 1 cut(s) 424
BmsI GCATC 1 cut(s) 218
BpiI GAAGAC 2 cut(s) 290, 591
BpmI CTGGAG 1 cut(s) 406
Bpu10I CCTNAGC 1 cut(s) 312
Bpu14I TTCGAA 1 cut(s) 138
BpuEI CTTGAG 2 cut(s) 371, 382
BsaBI GATNNNNATC 2 cut(s) 111, 117
BsaJI CCNNGG 2 cut(s) 299, 668
Bsc4I CCNNNNNNNGG 3 cut(s) 43, 547, 580
Bse3DI GCAATG 1 cut(s) 206
Bse8I GATNNNNATC 2 cut(s) 111, 117
BseBI CCWGG 1 cut(s) 424
BseDI CCNNGG 2 cut(s) 299, 668
BseGI GGATG 3 cut(s) 19, 68, 94
BseJI GATNNNNATC 2 cut(s) 111, 117
BseLI CCNNNNNNNGG 3 cut(s) 43, 547, 580
BseMI GCAATG 1 cut(s) 206
BseMII CTCAG 2 cut(s) 51, 303
BseRI GAGGAG 2 cut(s) 319, 321
BseYI CCCAGC 2 cut(s) 476, 511
BsgI GTGCAG 1 cut(s) 613
BshFI GGCC 1 cut(s) 427
BsiHKAI GWGCWC 1 cut(s) 357
BslFI GGGAC 1 cut(s) 308
BslI CCNNNNNNNGG 3 cut(s) 43, 547, 580
BsmFI GGGAC 1 cut(s) 308
BsnI GGCC 1 cut(s) 427
Bsp119I TTCGAA 1 cut(s) 138
Bsp1286I GDGCHC 4 cut(s) 311, 318, 357, 519
Bsp143I GATC 9 cut(s) 106, 112, 118, 365, 381, 403, 460, 526, 640
BspANI GGCC 1 cut(s) 427
BspCNI CTCAG 2 cut(s) 52, 304
BspHI TCATGA 2 cut(s) 109, 115
BspLI GGNNCC 5 cut(s) 296, 297, 308, 474, 518
BspMI ACCTGC 2 cut(s) 585, 613
BspPI GGATC 1 cut(s) 360
BspT104I TTCGAA 1 cut(s) 138
BsrDI GCAATG 1 cut(s) 206
BssECI CCNNGG 2 cut(s) 299, 668
BssMI GATC 9 cut(s) 106, 112, 118, 365, 381, 403, 460, 526, 640
BssT1I CCWWGG 2 cut(s) 299, 668
Bst2UI CCWGG 1 cut(s) 424
Bst4CI ACNGT 1 cut(s) 559
BstAPI GCANNNNNTGC 1 cut(s) 570
BstBI TTCGAA 1 cut(s) 138
BstC8I GCNNGC 1 cut(s) 610
BstDEI CTNAG 3 cut(s) 60, 312, 343
BstF5I GGATG 3 cut(s) 19, 68, 94
BstKTI GATC 9 cut(s) 109, 115, 121, 368, 384, 406, 463, 529, 643
BstMBI GATC 9 cut(s) 106, 112, 118, 365, 381, 403, 460, 526, 640
BstMWI GCNNNNNNNGC 2 cut(s) 570, 618
BstNI CCWGG 1 cut(s) 424
BstNSI RCATGY 3 cut(s) 580, 612, 631
BstSCI CCNGG 1 cut(s) 422
BstV2I GAAGAC 2 cut(s) 290, 591
BstX2I RGATCY 1 cut(s) 365
BstYI RGATCY 1 cut(s) 365
BsuRI GGCC 1 cut(s) 427
BtsCI GGATG 3 cut(s) 19, 68, 94
BtsI GCAGTG 1 cut(s) 418
BtsIMutI CAGTG 2 cut(s) 418, 555
BveI ACCTGC 2 cut(s) 585, 613
Cac8I GCNNGC 1 cut(s) 610
CaiI CAGNNNCTG 1 cut(s) 59
CciI TCATGA 2 cut(s) 109, 115
Cfr13I GGNCC 1 cut(s) 295
Csp6I GTAC 1 cut(s) 625
CviQI GTAC 1 cut(s) 625
DdeI CTNAG 3 cut(s) 60, 312, 343
DpnI GATC 9 cut(s) 108, 114, 120, 367, 383, 405, 462, 528, 642
DpnII GATC 9 cut(s) 106, 112, 118, 365, 381, 403, 460, 526, 640
DraIII CACNNNGTG 1 cut(s) 561
Ecl136II GAGCTC 1 cut(s) 355
Eco130I CCWWGG 2 cut(s) 299, 668
Eco147I AGGCCT 1 cut(s) 427
Eco24I GRGCYC 4 cut(s) 311, 318, 357, 519
Eco47I GGWCC 1 cut(s) 295
Eco53kI GAGCTC 1 cut(s) 355
EcoICRI GAGCTC 1 cut(s) 355
EcoO109I RGGNCCY 1 cut(s) 295
EcoRI GAATTC 1 cut(s) 64
EcoRII CCWGG 1 cut(s) 422
EcoT14I CCWWGG 2 cut(s) 299, 668
EcoT38I GRGCYC 4 cut(s) 311, 318, 357, 519
ErhI CCWWGG 2 cut(s) 299, 668
FaqI GGGAC 1 cut(s) 308
FauNDI CATATG 1 cut(s) 100
FbaI TGATCA 6 cut(s) 106, 112, 118, 381, 526, 640
FokI GGATG 3 cut(s) 6, 55, 101
FriOI GRGCYC 4 cut(s) 311, 318, 357, 519
FspBI CTAG 1 cut(s) 291
GsaI CCCAGC 2 cut(s) 480, 515
GsuI CTGGAG 1 cut(s) 406
HaeIII GGCC 1 cut(s) 427
HinfI GANTC 2 cut(s) 56, 374
HphI GGTGA 3 cut(s) 185, 530, 594
Hpy188I TCNGA 3 cut(s) 61, 403, 436
Hpy188III TCNNGA 3 cut(s) 110, 116, 385
HpyAV CCTTC 2 cut(s) 37, 455
HpyCH4III ACNGT 1 cut(s) 559
HpyCH4V TGCA 5 cut(s) 564, 594, 608, 621, 631
HpyF10VI GCNNNNNNNGC 2 cut(s) 570, 618
HpyF3I CTNAG 3 cut(s) 60, 312, 343
KflI GGGWCCC 1 cut(s) 295
Ksp22I TGATCA 6 cut(s) 106, 112, 118, 381, 526, 640
Kzo9I GATC 9 cut(s) 106, 112, 118, 365, 381, 403, 460, 526, 640
LmnI GCTCC 3 cut(s) 306, 334, 522
LweI GCATC 1 cut(s) 218
MaeI CTAG 1 cut(s) 291
MalI GATC 9 cut(s) 108, 114, 120, 367, 383, 405, 462, 528, 642
MboI GATC 9 cut(s) 106, 112, 118, 365, 381, 403, 460, 526, 640
MboII GAAGA 4 cut(s) 52, 295, 524, 591
MflI RGATCY 1 cut(s) 365
MhlI GDGCHC 4 cut(s) 311, 318, 357, 519
MluCI AATT 6 cut(s) 64, 132, 430, 451, 522, 616
MlyI GAGTC 2 cut(s) 65, 383
MmeI TCCRAC 1 cut(s) 128
MnlI CCTC 2 cut(s) 297, 342
MslI CAYNNNNRTG 3 cut(s) 114, 411, 607
MspR9I CCNGG 1 cut(s) 424
MvaI CCWGG 1 cut(s) 424
MwoI GCNNNNNNNGC 2 cut(s) 570, 618
NdeI CATATG 1 cut(s) 100
NdeII GATC 9 cut(s) 106, 112, 118, 365, 381, 403, 460, 526, 640
NlaIV GGNNCC 5 cut(s) 296, 297, 308, 474, 518
NspI RCATGY 3 cut(s) 580, 612, 631
NspV TTCGAA 1 cut(s) 138
OliI CACNNNNGTG 1 cut(s) 411
PaeI GCATGC 1 cut(s) 612
PagI TCATGA 2 cut(s) 109, 115
PaqCI CACCTGC 1 cut(s) 613
PceI AGGCCT 1 cut(s) 427
PciI ACATGT 1 cut(s) 576
PflMI CCANNNNNTGG 2 cut(s) 547, 580
PleI GAGTC 2 cut(s) 64, 382
PpsI GAGTC 2 cut(s) 64, 382
PpuMI RGGWCCY 1 cut(s) 295
PscI ACATGT 1 cut(s) 576
Psp124BI GAGCTC 1 cut(s) 357
Psp5II RGGWCCY 1 cut(s) 295
Psp6I CCWGG 1 cut(s) 422
PspFI CCCAGC 2 cut(s) 476, 511
PspGI CCWGG 1 cut(s) 422
PspN4I GGNNCC 5 cut(s) 296, 297, 308, 474, 518
PspPI GGNCC 1 cut(s) 295
PspPPI RGGWCCY 1 cut(s) 295
PstNI CAGNNNCTG 1 cut(s) 59
PsuI RGATCY 1 cut(s) 365
RsaI GTAC 1 cut(s) 626
RsaNI GTAC 1 cut(s) 625
RseI CAYNNNNRTG 3 cut(s) 114, 411, 607
SacI GAGCTC 1 cut(s) 357
Sau3AI GATC 9 cut(s) 106, 112, 118, 365, 381, 403, 460, 526, 640
Sau96I GGNCC 1 cut(s) 295
SchI GAGTC 2 cut(s) 65, 383
ScrFI CCNGG 1 cut(s) 424
SduI GDGCHC 4 cut(s) 311, 318, 357, 519
SfaNI GCATC 1 cut(s) 218
SfuI TTCGAA 1 cut(s) 138
SinI GGWCC 1 cut(s) 295
SmiMI CAYNNNNRTG 3 cut(s) 114, 411, 607
SmlI CTYRAG 2 cut(s) 350, 361
SmoI CTYRAG 2 cut(s) 350, 361
SphI GCATGC 1 cut(s) 612
Sse9I AATT 6 cut(s) 64, 132, 430, 451, 522, 616
SseBI AGGCCT 1 cut(s) 427
SspI AATATT 1 cut(s) 397
SspMI CTAG 1 cut(s) 291
SstI GAGCTC 1 cut(s) 357
StuI AGGCCT 1 cut(s) 427
StyD4I CCNGG 1 cut(s) 422
StyI CCWWGG 2 cut(s) 299, 668
TaaI ACNGT 1 cut(s) 559
TaqI TCGA 2 cut(s) 126, 138
TasI AATT 6 cut(s) 64, 132, 430, 451, 522, 616
TatI WGTACW 1 cut(s) 624
TscAI CASTG 2 cut(s) 418, 562
TspDTI ATGAA 6 cut(s) 57, 296, 457, 524, 581, 673
TspRI CASTG 2 cut(s) 418, 562
Van91I CCANNNNNTGG 2 cut(s) 547, 580
VpaK11BI GGWCC 1 cut(s) 295
XapI RAATTY 2 cut(s) 64, 132
XceI RCATGY 3 cut(s) 580, 612, 631
XspI CTAG 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.