Prupe.1G563700_v2.0.a1

Binds directly to 23S ribosomal RNA and is necessary for the in vitro assembly process of the 50S ribosomal subunit. It is not involved in the protein synthesizing functions of that subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
46045851 .. 46048719
2869 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G563700.2

Sequence Viewer

Length: 378 bp
ATGAACAAGGATAAGATATTCAAGTTAGCCAAGGGCTTCAGGGGAAGGGCCAAGAATTGCATAAGGATTGCCAGAGAGAGGGTGGAGAAGGCCTTGCAGTATTCCTACAGGGATCGCCGCACCAAGAAGCGAGATATGCGCTCCCTGTGGATCCAACGCATCAATGCTGGCACCCGCATCCATGGTGTTAATTATGGGAATTTCATGCATGGGTTGATGAAGGAGAACATTCAGCTGAACAGGAAAGTTTTGTCAGAGCTGTCCATGCACGAACCATACAGTTTCAAGGCCCTAGTAGACATCTCTCGCACTGCCTTCCCTGGGAACAAGAACGTGGTTCATGCTCCCAAAAAGGAAGGCCTTTCAATGCTTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

14.62

Weight (kDa)

10.75

Isoelectric Point (pI)

33.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 170
AccI GTMKAC 1 cut(s) 297
AciI CCGC 2 cut(s) 118, 175
AclWI GGATC 3 cut(s) 120, 145, 158
AcsI RAATTY 1 cut(s) 199
AcuI CTGAAG 1 cut(s) 22
AfiI CCNNNNNNNGG 2 cut(s) 78, 321
AgsI TTSAA 3 cut(s) 22, 286, 366
AjnI CCWGG 1 cut(s) 319
AluBI AGCT 2 cut(s) 235, 259
AluI AGCT 2 cut(s) 235, 259
AlwI GGATC 3 cut(s) 120, 145, 158
AoxI GGCC 4 cut(s) 48, 90, 288, 358
ApoI RAATTY 1 cut(s) 199
AspLEI GCGC 1 cut(s) 141
AspS9I GGNCC 2 cut(s) 48, 289
BamHI GGATCC 1 cut(s) 150
BanI GGYRCC 1 cut(s) 170
BciT130I CCWGG 1 cut(s) 321
BfaI CTAG 1 cut(s) 293
BfmI CTRYAG 1 cut(s) 106
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 321
BmgT120I GGNCC 2 cut(s) 48, 289
BmiI GGNNCC 2 cut(s) 152, 172
BmrFI CCNGG 1 cut(s) 321
BmsI GCATC 2 cut(s) 168, 186
BsaJI CCNNGG 4 cut(s) 30, 181, 319, 320
Bsc4I CCNNNNNNNGG 2 cut(s) 78, 321
BseBI CCWGG 1 cut(s) 321
BseDI CCNNGG 4 cut(s) 30, 181, 319, 320
BseGI GGATG 1 cut(s) 177
BseLI CCNNNNNNNGG 2 cut(s) 78, 321
BshFI GGCC 4 cut(s) 50, 92, 290, 360
BshNI GGYRCC 1 cut(s) 170
BslI CCNNNNNNNGG 2 cut(s) 78, 321
BsnI GGCC 4 cut(s) 50, 92, 290, 360
Bsp143I GATC 2 cut(s) 112, 150
Bsp19I CCATGG 1 cut(s) 181
BspACI CCGC 2 cut(s) 118, 175
BspANI GGCC 4 cut(s) 50, 92, 290, 360
BspLI GGNNCC 2 cut(s) 152, 172
BspPI GGATC 3 cut(s) 120, 145, 158
BspT107I GGYRCC 1 cut(s) 170
BssECI CCNNGG 4 cut(s) 30, 181, 319, 320
BssMI GATC 2 cut(s) 112, 150
BssT1I CCWWGG 2 cut(s) 30, 181
Bst2UI CCWGG 1 cut(s) 321
Bst4CI ACNGT 1 cut(s) 281
BstC8I GCNNGC 1 cut(s) 169
BstDSI CCRYGG 1 cut(s) 181
BstF5I GGATG 1 cut(s) 177
BstHHI GCGC 1 cut(s) 141
BstKTI GATC 2 cut(s) 115, 153
BstMBI GATC 2 cut(s) 112, 150
BstMWI GCNNNNNNNGC 2 cut(s) 136, 265
BstNI CCWGG 1 cut(s) 321
BstSCI CCNGG 1 cut(s) 319
BstSFI CTRYAG 1 cut(s) 106
BstX2I RGATCY 1 cut(s) 150
BstYI RGATCY 1 cut(s) 150
BsuRI GGCC 4 cut(s) 50, 92, 290, 360
BtgI CCRYGG 1 cut(s) 181
BtsCI GGATG 1 cut(s) 177
BtsI GCAGTG 1 cut(s) 309
BtsIMutI CAGTG 1 cut(s) 309
Cac8I GCNNGC 1 cut(s) 169
CfoI GCGC 1 cut(s) 141
Cfr13I GGNCC 2 cut(s) 48, 289
CviAII CATG 5 cut(s) 182, 205, 209, 265, 341
CviJI RGCY 8 cut(s) 29, 36, 50, 92, 235, 259, 290, 360
CviKI_1 RGCY 8 cut(s) 29, 36, 50, 92, 235, 259, 290, 360
DpnI GATC 2 cut(s) 114, 152
DpnII GATC 2 cut(s) 112, 150
Eco130I CCWWGG 2 cut(s) 30, 181
Eco147I AGGCCT 2 cut(s) 92, 360
Eco57I CTGAAG 1 cut(s) 22
EcoO109I RGGNCCY 1 cut(s) 289
EcoRII CCWGG 1 cut(s) 319
EcoT14I CCWWGG 2 cut(s) 30, 181
EcoT22I ATGCAT 1 cut(s) 210
ErhI CCWWGG 2 cut(s) 30, 181
FaeI CATG 5 cut(s) 185, 208, 212, 268, 344
FaiI YATR 9 cut(s) 62, 137, 183, 195, 206, 210, 266, 277, 342
FatI CATG 5 cut(s) 181, 204, 208, 264, 340
FauI CCCGC 1 cut(s) 182
FblI GTMKAC 1 cut(s) 297
Fnu4HI GCNGC 1 cut(s) 118
FokI GGATG 1 cut(s) 164
Fsp4HI GCNGC 1 cut(s) 118
FspBI CTAG 1 cut(s) 293
GlaI GCGC 1 cut(s) 140
GluI GCNGC 1 cut(s) 118
HaeIII GGCC 4 cut(s) 50, 92, 290, 360
HhaI GCGC 1 cut(s) 141
Hin1II CATG 5 cut(s) 185, 208, 212, 268, 344
Hin6I GCGC 1 cut(s) 139
HinP1I GCGC 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 298
Hpy188I TCNGA 1 cut(s) 256
Hpy8I GTNNAC 1 cut(s) 298
HpyAV CCTTC 5 cut(s) 39, 82, 214, 325, 350
HpyCH4III ACNGT 1 cut(s) 281
HpyCH4IV ACGT 1 cut(s) 333
HpyCH4V TGCA 4 cut(s) 60, 97, 208, 268
HpyF10VI GCNNNNNNNGC 2 cut(s) 136, 265
HpySE526I ACGT 1 cut(s) 333
Hsp92II CATG 5 cut(s) 185, 208, 212, 268, 344
HspAI GCGC 1 cut(s) 139
Kzo9I GATC 2 cut(s) 112, 150
LmnI GCTCC 2 cut(s) 146, 349
LpnPI CCDG 8 cut(s) 25, 85, 94, 153, 158, 226, 306, 333
LweI GCATC 2 cut(s) 168, 186
MaeI CTAG 1 cut(s) 293
MaeII ACGT 1 cut(s) 333
MalI GATC 2 cut(s) 114, 152
MboI GATC 2 cut(s) 112, 150
MflI RGATCY 1 cut(s) 150
MluCI AATT 3 cut(s) 55, 190, 199
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 1 cut(s) 72
Mph1103I ATGCAT 1 cut(s) 210
MseI TTAA 1 cut(s) 189
MspA1I CMGCKG 1 cut(s) 235
MspR9I CCNGG 1 cut(s) 321
MvaI CCWGG 1 cut(s) 321
MwoI GCNNNNNNNGC 2 cut(s) 136, 265
NcoI CCATGG 1 cut(s) 181
NdeII GATC 2 cut(s) 112, 150
NlaIII CATG 5 cut(s) 185, 208, 212, 268, 344
NlaIV GGNNCC 2 cut(s) 152, 172
NsiI ATGCAT 1 cut(s) 210
PasI CCCWGGG 1 cut(s) 320
PceI AGGCCT 2 cut(s) 92, 360
PkrI GCNGC 1 cut(s) 119
Psp6I CCWGG 1 cut(s) 319
PspGI CCWGG 1 cut(s) 319
PspN4I GGNNCC 2 cut(s) 152, 172
PspPI GGNCC 2 cut(s) 48, 289
PsuI RGATCY 1 cut(s) 150
PvuII CAGCTG 1 cut(s) 235
SaqAI TTAA 1 cut(s) 189
SatI GCNGC 1 cut(s) 118
Sau3AI GATC 2 cut(s) 112, 150
Sau96I GGNCC 2 cut(s) 48, 289
ScrFI CCNGG 1 cut(s) 321
SetI ASST 3 cut(s) 237, 261, 336
SfaNI GCATC 2 cut(s) 168, 186
SfcI CTRYAG 1 cut(s) 106
Sse9I AATT 3 cut(s) 55, 190, 199
SseBI AGGCCT 2 cut(s) 92, 360
SsiI CCGC 2 cut(s) 118, 175
SspMI CTAG 1 cut(s) 293
StuI AGGCCT 2 cut(s) 92, 360
StyD4I CCNGG 1 cut(s) 319
StyI CCWWGG 2 cut(s) 30, 181
TaaI ACNGT 1 cut(s) 281
TaiI ACGT 1 cut(s) 336
TasI AATT 3 cut(s) 55, 190, 199
TauI GCSGC 1 cut(s) 120
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TscAI CASTG 1 cut(s) 316
TspDTI ATGAA 4 cut(s) 17, 193, 233, 329
TspRI CASTG 1 cut(s) 316
XapI RAATTY 1 cut(s) 199
XcmI CCANNNNNNNNNTGG 1 cut(s) 79
XmiI GTMKAC 1 cut(s) 297
XspI CTAG 1 cut(s) 293
Zsp2I ATGCAT 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.