Rh5BG165200

Binds directly to 23S ribosomal RNA and is necessary for the in vitro assembly process of the 50S ribosomal subunit. It is not involved in the protein synthesizing functions of that subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
17262857 .. 17264307
1451 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG165200.1

Sequence Viewer

Length: 375 bp
ATGCATAAGGATAAGATTTTCAAGCTTGCCAAGGGCTTCAGGGGAAGGGCCAAGAACTGCATAAGGATAGCCAGAGAGAGGGTGGAGAAGGCCTTGCAGTATTCCTACAGAGATCGTCGCACCAAGAAGAGGGACATGCGTGCGCTGTGGATCCAACGTATCAATGCTGGCACCCGCATTCATGGTGTTAATTATGGGAATTTCATGCATGGACTGATGAAGGAGAACATTCAGCTAAACAGGAAAGTTTTATCAGAGCTTTCTATGCACGAACCATACACTTTCAAGGCCCTCGTAGATGTCTCTCACAGCGCATTCCCAGGGAACAAGGCCGTACTTCCTCCCAAAAAGGAAGGCCTCCAAATTCTTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

14.48

Weight (kDa)

10.62

Isoelectric Point (pI)

39.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L20 PF00453 3 - 98 2.1e-41 Ribosomal protein L20
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 170
AciI CCGC 1 cut(s) 175
AclWI GGATC 2 cut(s) 145, 158
AcsI RAATTY 2 cut(s) 199, 363
AcuI CTGAAG 1 cut(s) 22
AfaI GTAC 1 cut(s) 336
AfiI CCNNNNNNNGG 2 cut(s) 78, 129
AgsI TTSAA 2 cut(s) 22, 286
AjnI CCWGG 1 cut(s) 319
AluBI AGCT 3 cut(s) 25, 235, 259
AluI AGCT 3 cut(s) 25, 235, 259
Alw26I GTCTC 1 cut(s) 307
AlwI GGATC 2 cut(s) 145, 158
AoxI GGCC 5 cut(s) 48, 90, 288, 330, 355
ApoI RAATTY 2 cut(s) 199, 363
AspLEI GCGC 2 cut(s) 145, 314
AspS9I GGNCC 2 cut(s) 48, 289
BamHI GGATCC 1 cut(s) 150
BanI GGYRCC 1 cut(s) 170
BceAI ACGGC 1 cut(s) 317
BciT130I CCWGG 1 cut(s) 321
BcoDI GTCTC 1 cut(s) 307
BfmI CTRYAG 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 321
BmgT120I GGNCC 2 cut(s) 48, 289
BmiI GGNNCC 2 cut(s) 152, 172
BmrFI CCNGG 1 cut(s) 321
BsaJI CCNNGG 3 cut(s) 30, 319, 320
Bsc4I CCNNNNNNNGG 2 cut(s) 78, 129
BseBI CCWGG 1 cut(s) 321
BseDI CCNNGG 3 cut(s) 30, 319, 320
BseLI CCNNNNNNNGG 2 cut(s) 78, 129
BshFI GGCC 5 cut(s) 50, 92, 290, 332, 357
BshNI GGYRCC 1 cut(s) 170
BslFI GGGAC 1 cut(s) 146
BslI CCNNNNNNNGG 2 cut(s) 78, 129
BsmAI GTCTC 1 cut(s) 307
BsmFI GGGAC 1 cut(s) 146
BsmI GAATGC 2 cut(s) 177, 314
BsnI GGCC 5 cut(s) 50, 92, 290, 332, 357
Bsp143I GATC 2 cut(s) 112, 150
BspACI CCGC 1 cut(s) 175
BspANI GGCC 5 cut(s) 50, 92, 290, 332, 357
BspLI GGNNCC 2 cut(s) 152, 172
BspPI GGATC 2 cut(s) 145, 158
BspT107I GGYRCC 1 cut(s) 170
BssECI CCNNGG 3 cut(s) 30, 319, 320
BssMI GATC 2 cut(s) 112, 150
BssT1I CCWWGG 1 cut(s) 30
Bst2UI CCWGG 1 cut(s) 321
Bst6I CTCTTC 1 cut(s) 122
BstC8I GCNNGC 3 cut(s) 27, 141, 169
BstHHI GCGC 2 cut(s) 145, 314
BstKTI GATC 2 cut(s) 115, 153
BstMAI GTCTC 1 cut(s) 307
BstMBI GATC 2 cut(s) 112, 150
BstMWI GCNNNNNNNGC 1 cut(s) 265
BstNI CCWGG 1 cut(s) 321
BstNSI RCATGY 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 319
BstSFI CTRYAG 1 cut(s) 106
BstX2I RGATCY 1 cut(s) 150
BstYI RGATCY 1 cut(s) 150
BsuRI GGCC 5 cut(s) 50, 92, 290, 332, 357
Cac8I GCNNGC 3 cut(s) 27, 141, 169
CfoI GCGC 2 cut(s) 145, 314
Cfr13I GGNCC 2 cut(s) 48, 289
Csp6I GTAC 1 cut(s) 335
CviAII CATG 4 cut(s) 136, 182, 205, 209
CviQI GTAC 1 cut(s) 335
DpnI GATC 2 cut(s) 114, 152
DpnII GATC 2 cut(s) 112, 150
Eam1104I CTCTTC 1 cut(s) 122
EarI CTCTTC 1 cut(s) 122
Eco130I CCWWGG 1 cut(s) 30
Eco147I AGGCCT 2 cut(s) 92, 357
Eco57I CTGAAG 1 cut(s) 22
EcoO109I RGGNCCY 1 cut(s) 289
EcoRII CCWGG 1 cut(s) 319
EcoT14I CCWWGG 1 cut(s) 30
EcoT22I ATGCAT 2 cut(s) 6, 210
ErhI CCWWGG 1 cut(s) 30
FaeI CATG 4 cut(s) 139, 185, 208, 212
FaiI YATR 9 cut(s) 6, 62, 137, 183, 195, 206, 210, 266, 277
FaqI GGGAC 1 cut(s) 146
FatI CATG 4 cut(s) 135, 181, 204, 208
FauI CCCGC 1 cut(s) 182
GlaI GCGC 2 cut(s) 144, 313
HaeIII GGCC 5 cut(s) 50, 92, 290, 332, 357
HhaI GCGC 2 cut(s) 145, 314
Hin1II CATG 4 cut(s) 139, 185, 208, 212
Hin6I GCGC 2 cut(s) 143, 312
HinP1I GCGC 2 cut(s) 143, 312
HindIII AAGCTT 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 256
Hpy99I CGWCG 1 cut(s) 120
HpyAV CCTTC 4 cut(s) 39, 82, 214, 347
HpyCH4IV ACGT 1 cut(s) 157
HpyCH4V TGCA 5 cut(s) 4, 60, 97, 208, 268
HpyF10VI GCNNNNNNNGC 1 cut(s) 265
HpySE526I ACGT 1 cut(s) 157
Hsp92II CATG 4 cut(s) 139, 185, 208, 212
HspAI GCGC 2 cut(s) 143, 312
Kzo9I GATC 2 cut(s) 112, 150
LpnPI CCDG 6 cut(s) 25, 85, 153, 226, 306, 333
MaeII ACGT 1 cut(s) 157
MalI GATC 2 cut(s) 114, 152
MboI GATC 2 cut(s) 112, 150
MboII GAAGA 1 cut(s) 139
MflI RGATCY 1 cut(s) 150
MluCI AATT 3 cut(s) 190, 199, 363
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 5 cut(s) 72, 123, 302, 351, 368
Mph1103I ATGCAT 2 cut(s) 6, 210
MseI TTAA 1 cut(s) 189
MspR9I CCNGG 1 cut(s) 321
Mva1269I GAATGC 2 cut(s) 177, 314
MvaI CCWGG 1 cut(s) 321
MwoI GCNNNNNNNGC 1 cut(s) 265
NdeII GATC 2 cut(s) 112, 150
NlaIII CATG 4 cut(s) 139, 185, 208, 212
NlaIV GGNNCC 2 cut(s) 152, 172
NsiI ATGCAT 2 cut(s) 6, 210
NspI RCATGY 1 cut(s) 139
PasI CCCWGGG 1 cut(s) 320
PceI AGGCCT 2 cut(s) 92, 357
PctI GAATGC 2 cut(s) 177, 314
Psp6I CCWGG 1 cut(s) 319
PspGI CCWGG 1 cut(s) 319
PspN4I GGNNCC 2 cut(s) 152, 172
PspPI GGNCC 2 cut(s) 48, 289
PsuI RGATCY 1 cut(s) 150
RsaI GTAC 1 cut(s) 336
RsaNI GTAC 1 cut(s) 335
SaqAI TTAA 1 cut(s) 189
Sau3AI GATC 2 cut(s) 112, 150
Sau96I GGNCC 2 cut(s) 48, 289
ScrFI CCNGG 1 cut(s) 321
SetI ASST 4 cut(s) 27, 160, 237, 261
SfcI CTRYAG 1 cut(s) 106
Sse9I AATT 3 cut(s) 190, 199, 363
SseBI AGGCCT 2 cut(s) 92, 357
SsiI CCGC 1 cut(s) 175
StuI AGGCCT 2 cut(s) 92, 357
StyD4I CCNGG 1 cut(s) 319
StyI CCWWGG 1 cut(s) 30
TaiI ACGT 1 cut(s) 160
TasI AATT 3 cut(s) 190, 199, 363
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TspDTI ATGAA 3 cut(s) 170, 193, 233
XapI RAATTY 2 cut(s) 199, 363
XceI RCATGY 1 cut(s) 139
XcmI CCANNNNNNNNNTGG 1 cut(s) 79
Zsp2I ATGCAT 2 cut(s) 6, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.