Prupe.4G229900_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
14730998 .. 14732692
1695 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G229900.1

Sequence Viewer

Length: 186 bp
ATGGTGGTTTGCTTTCCGTCCACGCCCAAGAGGTTGGCTATGACAATAGGATGCTTCATTTCTGCTGCTGCTCTTTTTGCTTTTGGTGCTCATATCTCTTATGTCAATGTTGCCCCGCAACAAGCTCGAACCAAAGCTCGAAATGAGTTTGTGAGAGAACGGCTGAAACAGAAGTATGGCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.82

Weight (kDa)

10.39

Isoelectric Point (pI)

36.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 116
AluBI AGCT 2 cut(s) 125, 137
AluI AGCT 2 cut(s) 125, 137
Alw21I GWGCWC 1 cut(s) 91
ApeKI GCWGC 2 cut(s) 65, 68
Bbv12I GWGCWC 1 cut(s) 91
BbvI GCAGC 2 cut(s) 52, 55
BceAI ACGGC 1 cut(s) 176
BcgI CGANNNNNNTGC 2 cut(s) 107, 141
BisI GCNGC 2 cut(s) 66, 69
BlsI GCNGC 2 cut(s) 67, 70
BmsI GCATC 1 cut(s) 41
BseGI GGATG 1 cut(s) 56
BseXI GCAGC 2 cut(s) 52, 55
BsiHKAI GWGCWC 1 cut(s) 91
Bsp1286I GDGCHC 1 cut(s) 91
BspACI CCGC 1 cut(s) 116
BstF5I GGATG 1 cut(s) 56
BstMWI GCNNNNNNNGC 2 cut(s) 77, 86
BstV1I GCAGC 2 cut(s) 52, 55
BstXI CCANNNNNNTGG 1 cut(s) 34
BtsCI GGATG 1 cut(s) 56
CviJI RGCY 4 cut(s) 38, 125, 137, 163
CviKI_1 RGCY 4 cut(s) 38, 125, 137, 163
FaiI YATR 4 cut(s) 41, 93, 102, 177
FauI CCCGC 1 cut(s) 123
Fnu4HI GCNGC 2 cut(s) 66, 69
FokI GGATG 1 cut(s) 63
Fsp4HI GCNGC 2 cut(s) 66, 69
GluI GCNGC 2 cut(s) 66, 69
Hpy166II GTNNAC 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 21
HpyF10VI GCNNNNNNNGC 2 cut(s) 77, 86
Lsp1109I GCAGC 2 cut(s) 52, 55
LweI GCATC 1 cut(s) 41
MhlI GDGCHC 1 cut(s) 91
MnlI CCTC 1 cut(s) 24
MwoI GCNNNNNNNGC 2 cut(s) 77, 86
PkrI GCNGC 2 cut(s) 67, 70
SatI GCNGC 2 cut(s) 66, 69
SduI GDGCHC 1 cut(s) 91
SetI ASST 3 cut(s) 35, 127, 139
SfaNI GCATC 1 cut(s) 41
SgeI CNNG 6 cut(s) 34, 40, 127, 134, 138, 150
SsiI CCGC 1 cut(s) 116
TaqI TCGA 2 cut(s) 127, 139
TseI GCWGC 2 cut(s) 65, 68
TspDTI ATGAA 1 cut(s) 46
TspGWI ACGGA 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.