Rroxscaffold_1G00038590

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
56052285 .. 56053295
1011 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00038590.1

Sequence Viewer

Length: 186 bp
ATGGTGGTTTGCTATCCCTCCACACCGAAGAAGAAAGCTATGGCTTTGGGATTTTTCATTTCGGCTGCTGCTCTTTTCGCTTTCGGTGTGCATCTCTCCTATGTCAATGTTGCGCCTCAGCAAGCTCGAACCAAAGCTCGAAATGAGTTTGTAAGAGAACGATTGAAACAGAAATATGGGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.87

Weight (kDa)

10.36

Isoelectric Point (pI)

28.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 166
AluBI AGCT 3 cut(s) 38, 125, 137
AluI AGCT 3 cut(s) 38, 125, 137
ApeKI GCWGC 2 cut(s) 65, 68
AspLEI GCGC 1 cut(s) 115
BbvCI CCTCAGC 1 cut(s) 117
BbvI GCAGC 2 cut(s) 52, 55
BisI GCNGC 2 cut(s) 66, 69
BlsI GCNGC 2 cut(s) 67, 70
BmsI GCATC 1 cut(s) 100
Bpu10I CCTNAGC 1 cut(s) 117
BseMII CTCAG 1 cut(s) 131
BseXI GCAGC 2 cut(s) 52, 55
BspCNI CTCAG 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 117
BstHHI GCGC 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstV1I GCAGC 2 cut(s) 52, 55
Cac8I GCNNGC 1 cut(s) 123
CfoI GCGC 1 cut(s) 115
CviJI RGCY 5 cut(s) 38, 44, 65, 125, 137
CviKI_1 RGCY 5 cut(s) 38, 44, 65, 125, 137
DdeI CTNAG 1 cut(s) 117
FaiI YATR 3 cut(s) 41, 102, 177
Fnu4HI GCNGC 2 cut(s) 66, 69
Fsp4HI GCNGC 2 cut(s) 66, 69
GlaI GCGC 1 cut(s) 114
GluI GCNGC 2 cut(s) 66, 69
HhaI GCGC 1 cut(s) 115
Hin6I GCGC 1 cut(s) 113
HinP1I GCGC 1 cut(s) 113
HpyCH4V TGCA 1 cut(s) 91
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpyF3I CTNAG 1 cut(s) 117
HspAI GCGC 1 cut(s) 113
Lsp1109I GCAGC 2 cut(s) 52, 55
LweI GCATC 1 cut(s) 100
MboII GAAGA 2 cut(s) 40, 43
MnlI CCTC 2 cut(s) 28, 126
MwoI GCNNNNNNNGC 1 cut(s) 77
PkrI GCNGC 2 cut(s) 67, 70
SatI GCNGC 2 cut(s) 66, 69
SetI ASST 3 cut(s) 40, 127, 139
SfaNI GCATC 1 cut(s) 100
SgeI CNNG 3 cut(s) 134, 138, 150
TaqI TCGA 2 cut(s) 127, 139
TseI GCWGC 2 cut(s) 65, 68
TspDTI ATGAA 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.