Prupe.4G259300_v2.0.a1

Belongs to the CGI121 TPRKB family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
18608284 .. 18609275
992 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G259300.1

Sequence Viewer

Length: 177 bp
ATGCTTGTTTACAATTATTCAGGATCCAAGCATATCACAGAATCGTTGAAAAGATGTGGCATCTCTGAAAGCTTGACTTATGTGTTTTCCGCTCATTTTAATGCTTCTTCTGAAGAGCACTATAAGATAACTAGCGTGGAACTAGGGATATCTTCTCTTGCTGATGCCATTACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.39

Weight (kDa)

5.79

Isoelectric Point (pI)

46.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 92
AciI CCGC 1 cut(s) 90
AclWI GGATC 2 cut(s) 18, 31
AcuI CTGAAG 1 cut(s) 132
AgsI TTSAA 1 cut(s) 49
AluBI AGCT 1 cut(s) 72
AluI AGCT 1 cut(s) 72
Alw21I GWGCWC 1 cut(s) 120
AlwI GGATC 2 cut(s) 18, 31
BamHI GGATCC 1 cut(s) 23
Bbv12I GWGCWC 1 cut(s) 120
BfaI CTAG 2 cut(s) 132, 143
BmiI GGNNCC 1 cut(s) 25
BmsI GCATC 2 cut(s) 69, 154
BsiHKAI GWGCWC 1 cut(s) 120
Bsp1286I GDGCHC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 23
BspACI CCGC 1 cut(s) 90
BspLI GGNNCC 1 cut(s) 25
BspPI GGATC 2 cut(s) 18, 31
BspQI GCTCTTC 1 cut(s) 108
BsrBI CCGCTC 1 cut(s) 92
BssMI GATC 1 cut(s) 23
Bst6I CTCTTC 1 cut(s) 108
BstKTI GATC 1 cut(s) 26
BstMBI GATC 1 cut(s) 23
BstX2I RGATCY 1 cut(s) 23
BstYI RGATCY 1 cut(s) 23
CviJI RGCY 1 cut(s) 72
CviKI_1 RGCY 1 cut(s) 72
DpnI GATC 1 cut(s) 25
DpnII GATC 1 cut(s) 23
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
Eco32I GATATC 1 cut(s) 150
Eco57I CTGAAG 1 cut(s) 132
EcoRV GATATC 1 cut(s) 150
FaiI YATR 3 cut(s) 33, 81, 123
FalI AAGNNNNNCTT 2 cut(s) 61, 93
FspBI CTAG 2 cut(s) 132, 143
FspEI CC 7 cut(s) 6, 40, 42, 103, 122, 129, 130
HindIII AAGCTT 1 cut(s) 70
HinfI GANTC 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 10
Hpy188I TCNGA 2 cut(s) 67, 112
Hpy188III TCNNGA 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 10
Kzo9I GATC 1 cut(s) 23
LguI GCTCTTC 1 cut(s) 108
LpnPI CCDG 1 cut(s) 6
LweI GCATC 2 cut(s) 69, 154
MaeI CTAG 2 cut(s) 132, 143
MalI GATC 1 cut(s) 25
MbiI CCGCTC 1 cut(s) 92
MboI GATC 1 cut(s) 23
MboII GAAGA 3 cut(s) 99, 125, 144
MflI RGATCY 1 cut(s) 23
MhlI GDGCHC 1 cut(s) 120
MluCI AATT 1 cut(s) 13
MseI TTAA 1 cut(s) 99
MslI CAYNNNNRTG 1 cut(s) 99
NdeII GATC 1 cut(s) 23
NlaIV GGNNCC 1 cut(s) 25
PciSI GCTCTTC 1 cut(s) 108
PfeI GAWTC 1 cut(s) 41
PspN4I GGNNCC 1 cut(s) 25
PsuI RGATCY 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 99
SapI GCTCTTC 1 cut(s) 108
SaqAI TTAA 1 cut(s) 99
Sau3AI GATC 1 cut(s) 23
SduI GDGCHC 1 cut(s) 120
SetI ASST 1 cut(s) 74
SfaNI GCATC 2 cut(s) 69, 154
SgeI CNNG 8 cut(s) 17, 33, 40, 85, 144, 148, 155, 170
SmiMI CAYNNNNRTG 1 cut(s) 99
Sse9I AATT 1 cut(s) 13
SsiI CCGC 1 cut(s) 90
SspMI CTAG 2 cut(s) 132, 143
TasI AATT 1 cut(s) 13
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
XspI CTAG 2 cut(s) 132, 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.