Prupe.5G134800_v2.0.a1

Mitochondrial import inner membrane translocase subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Reverse (-)
12828131 .. 12829956
1826 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G134800.1

Sequence Viewer

Length: 270 bp
ATGGATTCGTTTTCATCCCCATCAAGTGGATCTTCTGCAACCCAATTCAACCCTGACGCTTTCAAGGACCAGCTTAAGAACCAACTTGCTCAGGCTTATGCCGAGGAGTTCTTGGAGACCCTGAGGTCAAAGTGCTTCGACAAGTGCATCACGAAACCAGGATCCAGCCTAGGTGGGAGTGAGAGTAGCTGCATCTCTAGATGTATGGATCGCTATATTGAGGCCACTGGCATCATCAGTAAAGCTCTCTTTAGTGCATCCCCACAATGA

Protein Analysis

90

Amino Acids

9.6

Weight (kDa)

5.24

Isoelectric Point (pI)

60.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013402)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 124
AccB7I CCANNNNNTGG 1 cut(s) 26
AclWI GGATC 4 cut(s) 37, 156, 169, 216
AfiI CCNNNNNNNGG 1 cut(s) 26
AflII CTTAAG 1 cut(s) 74
AgsI TTSAA 2 cut(s) 49, 64
AjnI CCWGG 1 cut(s) 157
AluBI AGCT 3 cut(s) 73, 189, 245
AluI AGCT 3 cut(s) 73, 189, 245
Alw26I GTCTC 1 cut(s) 110
AlwI GGATC 4 cut(s) 37, 156, 169, 216
AoxI GGCC 1 cut(s) 222
ApeKI GCWGC 1 cut(s) 189
AspA2I CCTAGG 1 cut(s) 169
AspS9I GGNCC 1 cut(s) 67
AvaII GGWCC 1 cut(s) 67
AvrII CCTAGG 1 cut(s) 169
AxyI CCTNAGG 1 cut(s) 122
BamHI GGATCC 1 cut(s) 161
BbvI GCAGC 1 cut(s) 176
BccI CCATC 1 cut(s) 28
BciT130I CCWGG 1 cut(s) 159
BcoDI GTCTC 1 cut(s) 110
BfaI CTAG 2 cut(s) 170, 198
BfrI CTTAAG 1 cut(s) 74
BisI GCNGC 1 cut(s) 190
BlnI CCTAGG 1 cut(s) 169
BlsI GCNGC 1 cut(s) 191
Bme1390I CCNGG 1 cut(s) 159
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 67
BmiI GGNNCC 1 cut(s) 163
BmrFI CCNGG 1 cut(s) 159
BmsI GCATC 4 cut(s) 156, 201, 240, 266
Bpu10I CCTNAGC 1 cut(s) 90
BsaI GGTCTC 1 cut(s) 110
BsaJI CCNNGG 2 cut(s) 102, 169
BsaXI ACNNNNNCTCC 2 cut(s) 169, 199
Bsc4I CCNNNNNNNGG 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 232
Bse21I CCTNAGG 1 cut(s) 122
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 2 cut(s) 102, 169
BseGI GGATG 2 cut(s) 14, 257
BseLI CCNNNNNNNGG 1 cut(s) 26
BseMII CTCAG 2 cut(s) 104, 113
BseNI ACTGG 1 cut(s) 232
BseRI GAGGAG 1 cut(s) 119
BseXI GCAGC 1 cut(s) 176
BshFI GGCC 1 cut(s) 224
BslI CCNNNNNNNGG 1 cut(s) 26
BsmAI GTCTC 1 cut(s) 110
BsnI GGCC 1 cut(s) 224
Bso31I GGTCTC 1 cut(s) 110
Bsp143I GATC 3 cut(s) 29, 161, 208
BspANI GGCC 1 cut(s) 224
BspCNI CTCAG 2 cut(s) 103, 114
BspLI GGNNCC 1 cut(s) 163
BspPI GGATC 4 cut(s) 37, 156, 169, 216
BspTI CTTAAG 1 cut(s) 74
BspTNI GGTCTC 1 cut(s) 110
BsrI ACTGG 1 cut(s) 232
BssECI CCNNGG 2 cut(s) 102, 169
BssMI GATC 3 cut(s) 29, 161, 208
BssT1I CCWWGG 1 cut(s) 169
Bst2UI CCWGG 1 cut(s) 159
BstAFI CTTAAG 1 cut(s) 74
BstDEI CTNAG 2 cut(s) 90, 122
BstF5I GGATG 2 cut(s) 14, 257
BstKTI GATC 3 cut(s) 32, 164, 211
BstMAI GTCTC 1 cut(s) 110
BstMBI GATC 3 cut(s) 29, 161, 208
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstV1I GCAGC 1 cut(s) 176
BstX2I RGATCY 2 cut(s) 29, 161
BstYI RGATCY 2 cut(s) 29, 161
Bsu36I CCTNAGG 1 cut(s) 122
BsuRI GGCC 1 cut(s) 224
BtsCI GGATG 2 cut(s) 14, 257
BtsIMutI CAGTG 1 cut(s) 225
Cfr13I GGNCC 1 cut(s) 67
CseI GACGC 1 cut(s) 65
CviJI RGCY 6 cut(s) 73, 95, 168, 189, 224, 245
CviKI_1 RGCY 6 cut(s) 73, 95, 168, 189, 224, 245
DdeI CTNAG 2 cut(s) 90, 122
DpnI GATC 3 cut(s) 31, 163, 210
DpnII GATC 3 cut(s) 29, 161, 208
DrdI GACNNNNNNGTC 1 cut(s) 124
DseDI GACNNNNNNGTC 1 cut(s) 124
Eco130I CCWWGG 1 cut(s) 169
Eco31I GGTCTC 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 67
Eco81I CCTNAGG 1 cut(s) 122
EcoRII CCWGG 1 cut(s) 157
EcoT14I CCWWGG 1 cut(s) 169
ErhI CCWWGG 1 cut(s) 169
FaiI YATR 3 cut(s) 99, 206, 216
FalI AAGNNNNNCTT 2 cut(s) 16, 48
Fnu4HI GCNGC 1 cut(s) 190
FokI GGATG 1 cut(s) 244
Fsp4HI GCNGC 1 cut(s) 190
FspBI CTAG 2 cut(s) 170, 198
GluI GCNGC 1 cut(s) 190
HaeIII GGCC 1 cut(s) 224
HgaI GACGC 1 cut(s) 65
HinfI GANTC 1 cut(s) 5
Hpy188III TCNNGA 2 cut(s) 151, 198
HpyCH4V TGCA 4 cut(s) 38, 147, 192, 257
HpyF3I CTNAG 2 cut(s) 90, 122
Kzo9I GATC 3 cut(s) 29, 161, 208
LpnPI CCDG 8 cut(s) 66, 77, 83, 134, 144, 171, 178, 213
Lsp1109I GCAGC 1 cut(s) 176
LweI GCATC 4 cut(s) 156, 201, 240, 266
MaeI CTAG 2 cut(s) 170, 198
MalI GATC 3 cut(s) 31, 163, 210
MboI GATC 3 cut(s) 29, 161, 208
MboII GAAGA 1 cut(s) 24
MflI RGATCY 2 cut(s) 29, 161
MluCI AATT 1 cut(s) 44
MnlI CCTC 3 cut(s) 97, 117, 214
MseI TTAA 1 cut(s) 75
MspCI CTTAAG 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
NdeII GATC 3 cut(s) 29, 161, 208
NlaIV GGNNCC 1 cut(s) 163
NmeAIII GCCGAG 1 cut(s) 127
PfeI GAWTC 1 cut(s) 5
PflMI CCANNNNNTGG 1 cut(s) 26
PkrI GCNGC 1 cut(s) 191
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
PspN4I GGNNCC 1 cut(s) 163
PspPI GGNCC 1 cut(s) 67
PsuI RGATCY 2 cut(s) 29, 161
SaqAI TTAA 1 cut(s) 75
SatI GCNGC 1 cut(s) 190
Sau3AI GATC 3 cut(s) 29, 161, 208
Sau96I GGNCC 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 159
SetI ASST 5 cut(s) 75, 128, 175, 191, 247
SfaNI GCATC 4 cut(s) 156, 201, 240, 266
SinI GGWCC 1 cut(s) 67
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 1 cut(s) 44
SspMI CTAG 2 cut(s) 170, 198
StyD4I CCNGG 1 cut(s) 157
StyI CCWWGG 1 cut(s) 169
TaqI TCGA 1 cut(s) 138
TasI AATT 1 cut(s) 44
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 232
TseI GCWGC 1 cut(s) 189
TspRI CASTG 1 cut(s) 232
Van91I CCANNNNNTGG 1 cut(s) 26
Vha464I CTTAAG 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 67
XbaI TCTAGA 1 cut(s) 197
XmaJI CCTAGG 1 cut(s) 169
XspI CTAG 2 cut(s) 170, 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.