Rroxscaffold_2G00082080

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
4957767 .. 4958586
820 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00082080.1

Sequence Viewer

Length: 228 bp
ATGATGGATTTTTCACCGTCGTCAAGCAGATCTTCTTCAACCCAATTCAACCCTGACATTTTCAAGAACCAGCTTCAGAATCAACTCGCTCGGCTTATGCCGAAGAGTTCTCCATCCGATCTCTCATCTTCTCTCTCTCTCTGTCGCTCTCCTGTTTCGCTCTGTGGTTTCAGTTACAGTCAAATCCATGGCTACCAGGTCAAGTCATCACCTGCAAAGCGGCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.32

Weight (kDa)

10.03

Isoelectric Point (pI)

92.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013402)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 220
Acc36I ACCTGC 1 cut(s) 220
AciI CCGC 2 cut(s) 220, 223
AcuI CTGAAG 1 cut(s) 59
AgsI TTSAA 3 cut(s) 39, 49, 64
AjnI CCWGG 1 cut(s) 195
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
AsuHPI GGTGA 2 cut(s) 6, 201
BccI CCATC 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 197
BfuAI ACCTGC 1 cut(s) 220
BglII AGATCT 1 cut(s) 29
BisI GCNGC 1 cut(s) 221
BlsI GCNGC 1 cut(s) 222
Bme1390I CCNGG 1 cut(s) 197
BmrFI CCNGG 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 187
BseBI CCWGG 1 cut(s) 197
BseDI CCNNGG 1 cut(s) 187
BseGI GGATG 1 cut(s) 113
Bsp143I GATC 2 cut(s) 29, 118
Bsp19I CCATGG 1 cut(s) 187
BspACI CCGC 2 cut(s) 220, 223
BspMI ACCTGC 1 cut(s) 220
BssECI CCNNGG 1 cut(s) 187
BssMI GATC 2 cut(s) 29, 118
BssT1I CCWWGG 1 cut(s) 187
Bst2UI CCWGG 1 cut(s) 197
Bst4CI ACNGT 2 cut(s) 18, 179
Bst6I CTCTTC 1 cut(s) 98
BstDSI CCRYGG 1 cut(s) 187
BstF5I GGATG 1 cut(s) 113
BstKTI GATC 2 cut(s) 32, 121
BstMBI GATC 2 cut(s) 29, 118
BstNI CCWGG 1 cut(s) 197
BstSCI CCNGG 1 cut(s) 195
BstX2I RGATCY 1 cut(s) 29
BstYI RGATCY 1 cut(s) 29
BtgI CCRYGG 1 cut(s) 187
BtsCI GGATG 1 cut(s) 113
BveI ACCTGC 1 cut(s) 220
CsiI ACCWGGT 1 cut(s) 195
CviAII CATG 1 cut(s) 188
CviJI RGCY 3 cut(s) 73, 94, 192
CviKI_1 RGCY 3 cut(s) 73, 94, 192
DpnI GATC 2 cut(s) 31, 120
DpnII GATC 2 cut(s) 29, 118
Eam1104I CTCTTC 1 cut(s) 98
EarI CTCTTC 1 cut(s) 98
Eco130I CCWWGG 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 59
EcoRII CCWGG 1 cut(s) 195
EcoT14I CCWWGG 1 cut(s) 187
ErhI CCWWGG 1 cut(s) 187
FaeI CATG 1 cut(s) 191
FaiI YATR 2 cut(s) 98, 189
FalI AAGNNNNNCTT 2 cut(s) 16, 48
FatI CATG 1 cut(s) 187
Fnu4HI GCNGC 1 cut(s) 221
FokI GGATG 1 cut(s) 100
Fsp4HI GCNGC 1 cut(s) 221
GluI GCNGC 1 cut(s) 221
Hin1II CATG 1 cut(s) 191
HinfI GANTC 1 cut(s) 79
HphI GGTGA 2 cut(s) 6, 201
Hpy188I TCNGA 2 cut(s) 78, 118
Hpy188III TCNNGA 1 cut(s) 64
Hpy99I CGWCG 1 cut(s) 22
HpyCH4III ACNGT 2 cut(s) 18, 179
HpyCH4V TGCA 1 cut(s) 215
Hsp92II CATG 1 cut(s) 191
Kzo9I GATC 2 cut(s) 29, 118
LpnPI CCDG 5 cut(s) 66, 83, 165, 182, 209
MabI ACCWGGT 1 cut(s) 195
MaeIII GTNAC 1 cut(s) 173
MalI GATC 2 cut(s) 31, 120
MboI GATC 2 cut(s) 29, 118
MboII GAAGA 4 cut(s) 24, 27, 115, 120
MflI RGATCY 1 cut(s) 29
MluCI AATT 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 197
MvaI CCWGG 1 cut(s) 197
NcoI CCATGG 1 cut(s) 187
NdeII GATC 2 cut(s) 29, 118
NlaIII CATG 1 cut(s) 191
NmeAIII GCCGAG 1 cut(s) 70
PaqCI CACCTGC 1 cut(s) 220
PfeI GAWTC 1 cut(s) 79
PkrI GCNGC 1 cut(s) 222
Psp6I CCWGG 1 cut(s) 195
PspGI CCWGG 1 cut(s) 195
PsuI RGATCY 1 cut(s) 29
SatI GCNGC 1 cut(s) 221
Sau3AI GATC 2 cut(s) 29, 118
ScrFI CCNGG 1 cut(s) 197
SetI ASST 3 cut(s) 75, 201, 214
SexAI ACCWGGT 1 cut(s) 195
Sse9I AATT 1 cut(s) 44
SsiI CCGC 2 cut(s) 220, 223
StyD4I CCNGG 1 cut(s) 195
StyI CCWWGG 1 cut(s) 187
TaaI ACNGT 2 cut(s) 18, 179
TasI AATT 1 cut(s) 44
TauI GCSGC 1 cut(s) 223
TfiI GAWTC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.