Prupe.6G043500_v2.0.a1

expressed protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
3175202 .. 3176236
1035 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G043500.1

Sequence Viewer

Length: 273 bp
ATGTGTCCCCTGAGGCTGATTTTGATCTTCCTCTCAGCCACTCTGGCTGGCTTCTTCGTCCTCAGAAACCTCAAATCCGACCCCAAATTGGATACTCCGCACCATGAAGAACATGAGACCAACCACCACCACCAAAACCCCAACAACTCTCCTAACCGATTTTCCAAGGTTCGGTCAGCCATGGAATCAGGGTTCTGGACCATTGTGGACATGGGCAGTGGACGCTATCTCTGGAGGCATTTTGTCTCAGCGTCCCCAAAACCATCGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.35

Weight (kDa)

9.51

Isoelectric Point (pI)

32.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016546)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G58375
fragaria_vesca FvH4_3g40240
malus_domestica MD03G1054900.v1.1 MD11G1056300.v1.1
prunus_persica Prupe.6G043500_v2.0.a1
pyrus_communis pycom03g04360 pycom11g04660
rosa_chinensis RchiOBHm_Chr5g0025021 RchiOBHm_Chr5g0072461
rosa_laevigata RLG00000033631
rosa_multiflora Rmu_sc0041000.1_g000001
rosa_roxburghii Rroxscaffold_1G00008740
rosa_samantha Rh5AG474900
rosa_wichuraiana Rw5G044090

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 98
AfiI CCNNNNNNNGG 2 cut(s) 88, 171
AloI GAACNNNNNNTCC 2 cut(s) 176, 208
Alw26I GTCTC 2 cut(s) 110, 250
AspS9I GGNCC 1 cut(s) 198
AvaII GGWCC 1 cut(s) 198
AxyI CCTNAGG 1 cut(s) 11
BccI CCATC 1 cut(s) 271
BciVI GTATCC 1 cut(s) 85
BcoDI GTCTC 2 cut(s) 110, 250
BfuI GTATCC 1 cut(s) 85
BglI GCCNNNNNGGC 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 198
BmgT120I GGNCC 1 cut(s) 198
BpmI CTGGAG 1 cut(s) 253
BsaBI GATNNNNATC 1 cut(s) 23
BsaI GGTCTC 1 cut(s) 110
BsaJI CCNNGG 2 cut(s) 165, 180
Bsc4I CCNNNNNNNGG 2 cut(s) 88, 171
Bse21I CCTNAGG 1 cut(s) 11
Bse8I GATNNNNATC 1 cut(s) 23
BseDI CCNNGG 2 cut(s) 165, 180
BseJI GATNNNNATC 1 cut(s) 23
BseLI CCNNNNNNNGG 2 cut(s) 88, 171
BseMII CTCAG 3 cut(s) 48, 76, 261
BslFI GGGAC 1 cut(s) 238
BslI CCNNNNNNNGG 2 cut(s) 88, 171
BsmAI GTCTC 2 cut(s) 110, 250
BsmFI GGGAC 1 cut(s) 238
Bso31I GGTCTC 1 cut(s) 110
Bsp143I GATC 1 cut(s) 24
Bsp19I CCATGG 1 cut(s) 180
BspACI CCGC 1 cut(s) 98
BspCNI CTCAG 3 cut(s) 47, 75, 260
BspTNI GGTCTC 1 cut(s) 110
BssECI CCNNGG 2 cut(s) 165, 180
BssMI GATC 1 cut(s) 24
BssT1I CCWWGG 2 cut(s) 165, 180
BstC8I GCNNGC 1 cut(s) 49
BstDEI CTNAG 4 cut(s) 11, 34, 62, 247
BstDSI CCRYGG 1 cut(s) 180
BstKTI GATC 1 cut(s) 27
BstMAI GTCTC 2 cut(s) 110, 250
BstMBI GATC 1 cut(s) 24
BstMWI GCNNNNNNNGC 2 cut(s) 44, 222
Bsu36I CCTNAGG 1 cut(s) 11
BsuI GTATCC 1 cut(s) 85
BtgI CCRYGG 1 cut(s) 180
BtsI GCAGTG 1 cut(s) 223
BtsIMutI CAGTG 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 198
CseI GACGC 2 cut(s) 231, 240
CviAII CATG 4 cut(s) 104, 113, 181, 211
CviJI RGCY 5 cut(s) 16, 38, 47, 51, 179
CviKI_1 RGCY 5 cut(s) 16, 38, 47, 51, 179
DdeI CTNAG 4 cut(s) 11, 34, 62, 247
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
Eco130I CCWWGG 2 cut(s) 165, 180
Eco31I GGTCTC 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 198
Eco81I CCTNAGG 1 cut(s) 11
EcoT14I CCWWGG 2 cut(s) 165, 180
ErhI CCWWGG 2 cut(s) 165, 180
FaeI CATG 4 cut(s) 107, 116, 184, 214
FaiI YATR 4 cut(s) 105, 114, 182, 212
FaqI GGGAC 1 cut(s) 238
FatI CATG 4 cut(s) 103, 112, 180, 210
GsuI CTGGAG 1 cut(s) 253
HgaI GACGC 2 cut(s) 231, 240
Hin1II CATG 4 cut(s) 107, 116, 184, 214
HinfI GANTC 1 cut(s) 185
Hpy166II GTNNAC 2 cut(s) 208, 221
Hpy188I TCNGA 2 cut(s) 65, 79
Hpy188III TCNNGA 2 cut(s) 196, 232
Hpy8I GTNNAC 2 cut(s) 208, 221
HpyF10VI GCNNNNNNNGC 2 cut(s) 44, 222
HpyF3I CTNAG 4 cut(s) 11, 34, 62, 247
Hsp92II CATG 4 cut(s) 107, 116, 184, 214
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 6 cut(s) 23, 29, 33, 174, 181, 217
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 3 cut(s) 19, 46, 119
MluCI AATT 2 cut(s) 86, 268
MmeI TCCRAC 1 cut(s) 102
MnlI CCTC 5 cut(s) 6, 41, 71, 80, 228
MwoI GCNNNNNNNGC 2 cut(s) 44, 222
NcoI CCATGG 1 cut(s) 180
NdeII GATC 1 cut(s) 24
NlaIII CATG 4 cut(s) 107, 116, 184, 214
PfeI GAWTC 1 cut(s) 185
PspPI GGNCC 1 cut(s) 198
Sau3AI GATC 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 198
SetI ASST 2 cut(s) 72, 171
SinI GGWCC 1 cut(s) 198
Sse9I AATT 2 cut(s) 86, 268
SsiI CCGC 1 cut(s) 98
StyI CCWWGG 2 cut(s) 165, 180
TaqI TCGA 1 cut(s) 266
TaqII GACCGA 1 cut(s) 162
TasI AATT 2 cut(s) 86, 268
TfiI GAWTC 1 cut(s) 185
TscAI CASTG 1 cut(s) 223
TspDTI ATGAA 1 cut(s) 120
TspRI CASTG 1 cut(s) 223
VpaK11BI GGWCC 1 cut(s) 198
XcmI CCANNNNNNNNNTGG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.