Prupe.6G196100_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
OG0014206
Physical Location & Seq
Reverse (-)
20383852 .. 20385150
1299 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G196100.2

Sequence Viewer

Length: 564 bp
ATGGACCAGCAAGGAAAATGCAACAATTCGGAGATACTAGATTTTTCAACGCTGCAGTCGAACGAGGCCACGAATTTAATCAACAGCACCGGTGCTTGGCTGTTAAATGAAAAGCCTGGGGCCTTTATCTCAGAAGAAGAGCTGAAGATTCGGAGTGAGGTCGAGAAGGATATAGAGAGAGACTTGGAGGAAGAAATCAAAGACGGGATATGTCATCTTGCTCTGAGATTGCACAGGCTTTATCAACACCAAAACGAAAGAAGATCAAGTTCTGCTGCTGCTCTTGCTGCTAGAGATGAAAGAAAGATGGAGAAAGCATTTTGTGAGGTGAACATAAACATCAAAATGGAAGGAGGAACCAAGATTGAAATAAAAGAGACCAAGAAACCAGCACCTCCTGATCAAAAGGGTAGTGGTCCTAATTGGTCCGGTACAAGATCAGAAAATTATATGCAACCATTTGTGAAGATGGCTAGAAATTCCAAGAAGTTTGATTGGGCCAAAACACTGAGGTCAAATGTTGGCCCTGTAGCCTTCACAAAGAAACCATGGCAGCCCACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

188

Amino Acids

21.29

Weight (kDa)

8.37

Isoelectric Point (pI)

64.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014206)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G26290
fragaria_vesca FvH4_1g20030
malus_domestica MD15G1315600.v1.1
prunus_persica Prupe.6G196100_v2.0.a1 Prupe.6G196100_v2.0.a1
pyrus_communis pycom15g27890
rosa_chinensis RchiOBHm_Chr2g0111971
rosa_laevigata RLG00000017942
rosa_multiflora Rmu_sc0005518.1_g000004
rosa_roxburghii Rroxscaffold_2G00131910
rosa_rugosa Rorug02G0177600 Rorug02G0177700
rosa_samantha Rh2AG229900 Rh2BG242700 Rh2CG234000 Rh2DG237700
rosa_wichuraiana Rw2G017800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 73, 478
AcuI CTGAAG 1 cut(s) 164
AfaI GTAC 1 cut(s) 433
AfiI CCNNNNNNNGG 1 cut(s) 96
AgeI ACCGGT 1 cut(s) 89
AgsI TTSAA 2 cut(s) 48, 368
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
Alw26I GTCTC 2 cut(s) 174, 371
AoxI GGCC 4 cut(s) 66, 120, 498, 523
ApeKI GCWGC 5 cut(s) 52, 275, 278, 287, 553
ApoI RAATTY 2 cut(s) 73, 478
AsiGI ACCGGT 1 cut(s) 89
AspS9I GGNCC 6 cut(s) 4, 120, 416, 426, 498, 524
AsuHPI GGTGA 1 cut(s) 340
AvaII GGWCC 3 cut(s) 4, 416, 426
BbvI GCAGC 4 cut(s) 39, 262, 265, 274
BccI CCATC 2 cut(s) 301, 463
BciT130I CCWGG 1 cut(s) 117
BclI TGATCA 1 cut(s) 400
BcoDI GTCTC 2 cut(s) 174, 371
BfaI CTAG 3 cut(s) 38, 291, 474
BfmI CTRYAG 2 cut(s) 53, 528
BisI GCNGC 5 cut(s) 53, 276, 279, 288, 554
BlsI GCNGC 5 cut(s) 54, 277, 280, 289, 555
Bme1390I CCNGG 1 cut(s) 117
Bme18I GGWCC 3 cut(s) 4, 416, 426
BmgT120I GGNCC 6 cut(s) 4, 120, 416, 426, 498, 524
BmiI GGNNCC 2 cut(s) 121, 358
BmrFI CCNGG 1 cut(s) 117
BsaI GGTCTC 1 cut(s) 371
BsaJI CCNNGG 2 cut(s) 116, 548
BsaWI WCCGGW 2 cut(s) 89, 428
Bsc4I CCNNNNNNNGG 1 cut(s) 96
Bse118I RCCGGY 1 cut(s) 89
BseBI CCWGG 1 cut(s) 117
BseDI CCNNGG 2 cut(s) 116, 548
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMII CTCAG 3 cut(s) 144, 215, 500
BseXI GCAGC 4 cut(s) 39, 262, 265, 274
BshFI GGCC 4 cut(s) 68, 122, 500, 525
BshTI ACCGGT 1 cut(s) 89
BsiSI CCGG 2 cut(s) 90, 429
BslI CCNNNNNNNGG 1 cut(s) 96
BsmAI GTCTC 2 cut(s) 174, 371
BsnI GGCC 4 cut(s) 68, 122, 500, 525
Bso31I GGTCTC 1 cut(s) 371
Bsp143I GATC 3 cut(s) 263, 400, 437
Bsp19I CCATGG 1 cut(s) 548
BspANI GGCC 4 cut(s) 68, 122, 500, 525
BspCNI CTCAG 3 cut(s) 143, 216, 501
BspLI GGNNCC 2 cut(s) 121, 358
BspMAI CTGCAG 1 cut(s) 57
BspQI GCTCTTC 1 cut(s) 132
BspTNI GGTCTC 1 cut(s) 371
BsrFI RCCGGY 1 cut(s) 89
BssAI RCCGGY 1 cut(s) 89
BssECI CCNNGG 2 cut(s) 116, 548
BssMI GATC 3 cut(s) 263, 400, 437
BssT1I CCWWGG 1 cut(s) 548
Bst2UI CCWGG 1 cut(s) 117
Bst6I CTCTTC 1 cut(s) 132
BstDEI CTNAG 3 cut(s) 130, 224, 509
BstDSI CCRYGG 1 cut(s) 548
BstKTI GATC 3 cut(s) 266, 403, 440
BstMAI GTCTC 2 cut(s) 174, 371
BstMBI GATC 3 cut(s) 263, 400, 437
BstMWI GCNNNNNNNGC 2 cut(s) 284, 287
BstNI CCWGG 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 115
BstSFI CTRYAG 2 cut(s) 53, 528
BstV1I GCAGC 4 cut(s) 39, 262, 265, 274
BsuRI GGCC 4 cut(s) 68, 122, 500, 525
BtgI CCRYGG 1 cut(s) 548
BtsIMutI CAGTG 1 cut(s) 506
Cfr10I RCCGGY 1 cut(s) 89
Cfr13I GGNCC 6 cut(s) 4, 120, 416, 426, 498, 524
Csp6I GTAC 1 cut(s) 432
CspAI ACCGGT 1 cut(s) 89
CviAII CATG 2 cut(s) 549, 561
CviQI GTAC 1 cut(s) 432
DdeI CTNAG 3 cut(s) 130, 224, 509
DpnI GATC 3 cut(s) 265, 402, 439
DpnII GATC 3 cut(s) 263, 400, 437
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
Eco130I CCWWGG 1 cut(s) 548
Eco31I GGTCTC 1 cut(s) 371
Eco47I GGWCC 3 cut(s) 4, 416, 426
Eco57I CTGAAG 1 cut(s) 164
EcoO109I RGGNCCY 1 cut(s) 120
EcoRII CCWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 548
ErhI CCWWGG 1 cut(s) 548
FaeI CATG 2 cut(s) 552, 564
FaiI YATR 7 cut(s) 173, 211, 335, 450, 452, 550, 562
FatI CATG 2 cut(s) 548, 560
FbaI TGATCA 1 cut(s) 400
Fnu4HI GCNGC 5 cut(s) 53, 276, 279, 288, 554
Fsp4HI GCNGC 5 cut(s) 53, 276, 279, 288, 554
FspBI CTAG 3 cut(s) 38, 291, 474
GluI GCNGC 5 cut(s) 53, 276, 279, 288, 554
HaeIII GGCC 4 cut(s) 68, 122, 500, 525
HapII CCGG 2 cut(s) 90, 429
Hin1II CATG 2 cut(s) 552, 564
HinfI GANTC 1 cut(s) 148
HpaII CCGG 2 cut(s) 90, 429
HphI GGTGA 1 cut(s) 340
Hpy166II GTNNAC 1 cut(s) 331
Hpy188I TCNGA 5 cut(s) 31, 133, 153, 225, 442
Hpy188III TCNNGA 2 cut(s) 163, 398
Hpy8I GTNNAC 1 cut(s) 331
HpyAV CCTTC 3 cut(s) 160, 344, 544
HpyCH4V TGCA 4 cut(s) 21, 55, 232, 454
HpyF10VI GCNNNNNNNGC 2 cut(s) 284, 287
HpyF3I CTNAG 3 cut(s) 130, 224, 509
Hsp92II CATG 2 cut(s) 552, 564
Ksp22I TGATCA 1 cut(s) 400
Kzo9I GATC 3 cut(s) 263, 400, 437
LguI GCTCTTC 1 cut(s) 132
LpnPI CCDG 9 cut(s) 20, 102, 103, 129, 220, 402, 411, 442, 540
Lsp1109I GCAGC 4 cut(s) 39, 262, 265, 274
MaeI CTAG 3 cut(s) 38, 291, 474
MalI GATC 3 cut(s) 265, 402, 439
MboI GATC 3 cut(s) 263, 400, 437
MboII GAAGA 6 cut(s) 146, 149, 157, 203, 273, 478
MluCI AATT 5 cut(s) 25, 73, 421, 445, 478
MnlI CCTC 7 cut(s) 58, 151, 181, 319, 347, 405, 504
MseI TTAA 2 cut(s) 77, 104
MslI CAYNNNNRTG 1 cut(s) 344
MspI CCGG 2 cut(s) 90, 429
MspR9I CCNGG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 117
MwoI GCNNNNNNNGC 2 cut(s) 284, 287
NcoI CCATGG 1 cut(s) 548
NdeII GATC 3 cut(s) 263, 400, 437
NlaIII CATG 2 cut(s) 552, 564
NlaIV GGNNCC 2 cut(s) 121, 358
PciSI GCTCTTC 1 cut(s) 132
PcsI WCGNNNNNNNCGW 1 cut(s) 56
PfeI GAWTC 1 cut(s) 148
PinAI ACCGGT 1 cut(s) 89
PkrI GCNGC 5 cut(s) 54, 277, 280, 289, 555
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PspN4I GGNNCC 2 cut(s) 121, 358
PspPI GGNCC 6 cut(s) 4, 120, 416, 426, 498, 524
PstI CTGCAG 1 cut(s) 57
RsaI GTAC 1 cut(s) 433
RsaNI GTAC 1 cut(s) 432
RseI CAYNNNNRTG 1 cut(s) 344
SapI GCTCTTC 1 cut(s) 132
SaqAI TTAA 2 cut(s) 77, 104
SatI GCNGC 5 cut(s) 53, 276, 279, 288, 554
Sau3AI GATC 3 cut(s) 263, 400, 437
Sau96I GGNCC 6 cut(s) 4, 120, 416, 426, 498, 524
ScrFI CCNGG 1 cut(s) 117
SetI ASST 5 cut(s) 144, 162, 330, 397, 515
SfcI CTRYAG 2 cut(s) 53, 528
SgrAI CRCCGGYG 1 cut(s) 89
SinI GGWCC 3 cut(s) 4, 416, 426
SmiMI CAYNNNNRTG 1 cut(s) 344
Sse9I AATT 5 cut(s) 25, 73, 421, 445, 478
SspMI CTAG 3 cut(s) 38, 291, 474
StyD4I CCNGG 1 cut(s) 115
StyI CCWWGG 1 cut(s) 548
TaqI TCGA 2 cut(s) 59, 162
TasI AATT 5 cut(s) 25, 73, 421, 445, 478
TfiI GAWTC 1 cut(s) 148
Tru1I TTAA 2 cut(s) 77, 104
Tru9I TTAA 2 cut(s) 77, 104
TscAI CASTG 1 cut(s) 513
TseI GCWGC 5 cut(s) 52, 275, 278, 287, 553
TspDTI ATGAA 2 cut(s) 123, 312
TspRI CASTG 1 cut(s) 513
VpaK11BI GGWCC 3 cut(s) 4, 416, 426
XapI RAATTY 2 cut(s) 73, 478
XspI CTAG 3 cut(s) 38, 291, 474
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.