Rh2CG234000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
23969901 .. 23971243
1343 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG234000.1

Sequence Viewer

Length: 453 bp
ATGCTACAGGTAAGCTTTAATGATCATGATCGTCTTAAGGGATTACAAGGCAAAAACAGGAGATTTTCTGGGGCCAGTGTTTCCGAAGAAGAGCTGAAGATTCGCAATGAGCTTGAAATGGAAGTAGAAAAAGACTTGGAGGAAGAAATCAAAGATGGGATATGCCATCTTGCTCTGAGATTGCACAGGCTTTATCAGCACCAAAAGGAGAGAAGTGCAAGCAAATTAGCATTTTGTGAGGTGAATATAAACATACAAATGGAAGGAGGAACCAAGATTGAAATAAAAGAGACCAAAAGGCCAGCACCAGCTGAAAGGGAAAAGAGCTTTCCTCCTCGGCCTAGTTCTAGATCATCTACTGTGAGATCAGTTATGAAAGTGGGTGCAAACACAAAGAAGTTTGATTGGGCCAAAAGTCTGAGATCGAGTGGTGGTCAAGGATGGAAAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

150

Amino Acids

17.15

Weight (kDa)

9.54

Isoelectric Point (pI)

65.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014206)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G26290
fragaria_vesca FvH4_1g20030
malus_domestica MD15G1315600.v1.1
prunus_persica Prupe.6G196100_v2.0.a1 Prupe.6G196100_v2.0.a1
pyrus_communis pycom15g27890
rosa_chinensis RchiOBHm_Chr2g0111971
rosa_laevigata RLG00000017942
rosa_multiflora Rmu_sc0005518.1_g000004
rosa_roxburghii Rroxscaffold_2G00131910
rosa_rugosa Rorug02G0177600 Rorug02G0177700
rosa_samantha Rh2AG229900 Rh2BG242700 Rh2CG234000 Rh2DG237700
rosa_wichuraiana Rw2G017800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 116
AflII CTTAAG 1 cut(s) 35
AgsI TTSAA 2 cut(s) 116, 281
AluBI AGCT 5 cut(s) 15, 94, 112, 311, 327
AluI AGCT 5 cut(s) 15, 94, 112, 311, 327
Alw26I GTCTC 1 cut(s) 284
AoxI GGCC 4 cut(s) 72, 299, 338, 408
AspS9I GGNCC 2 cut(s) 72, 408
AsuHPI GGTGA 1 cut(s) 253
BccI CCATC 3 cut(s) 149, 174, 435
BclI TGATCA 1 cut(s) 22
BcoDI GTCTC 1 cut(s) 284
BfaI CTAG 2 cut(s) 342, 348
BfmI CTRYAG 1 cut(s) 5
BfrI CTTAAG 1 cut(s) 35
BmgT120I GGNCC 2 cut(s) 72, 408
BmiI GGNNCC 2 cut(s) 73, 271
BplI GAGNNNNNCTC 2 cut(s) 316, 348
BsaBI GATNNNNATC 1 cut(s) 27
BsaI GGTCTC 1 cut(s) 284
BsaJI CCNNGG 1 cut(s) 335
Bse1I ACTGG 1 cut(s) 75
Bse3DI GCAATG 1 cut(s) 112
Bse8I GATNNNNATC 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 335
BseGI GGATG 1 cut(s) 446
BseJI GATNNNNATC 1 cut(s) 27
BseMI GCAATG 1 cut(s) 112
BseMII CTCAG 2 cut(s) 167, 410
BseNI ACTGG 1 cut(s) 75
BseRI GAGGAG 1 cut(s) 324
BshFI GGCC 4 cut(s) 74, 301, 340, 410
BsmAI GTCTC 1 cut(s) 284
BsnI GGCC 4 cut(s) 74, 301, 340, 410
Bso31I GGTCTC 1 cut(s) 284
Bsp143I GATC 5 cut(s) 22, 28, 350, 365, 422
BspANI GGCC 4 cut(s) 74, 301, 340, 410
BspCNI CTCAG 2 cut(s) 168, 411
BspHI TCATGA 1 cut(s) 25
BspLI GGNNCC 2 cut(s) 73, 271
BspQI GCTCTTC 1 cut(s) 84
BspTI CTTAAG 1 cut(s) 35
BspTNI GGTCTC 1 cut(s) 284
BsrDI GCAATG 1 cut(s) 112
BsrI ACTGG 1 cut(s) 75
BssECI CCNNGG 1 cut(s) 335
BssMI GATC 5 cut(s) 22, 28, 350, 365, 422
Bst4CI ACNGT 1 cut(s) 361
Bst6I CTCTTC 1 cut(s) 84
BstAFI CTTAAG 1 cut(s) 35
BstC8I GCNNGC 2 cut(s) 220, 303
BstDEI CTNAG 2 cut(s) 176, 419
BstF5I GGATG 1 cut(s) 446
BstKTI GATC 5 cut(s) 25, 31, 353, 368, 425
BstMAI GTCTC 1 cut(s) 284
BstMBI GATC 5 cut(s) 22, 28, 350, 365, 422
BstMWI GCNNNNNNNGC 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 5
BsuRI GGCC 4 cut(s) 74, 301, 340, 410
BtsCI GGATG 1 cut(s) 446
BtsIMutI CAGTG 1 cut(s) 82
Cac8I GCNNGC 2 cut(s) 220, 303
CciI TCATGA 1 cut(s) 25
Cfr13I GGNCC 2 cut(s) 72, 408
CviAII CATG 1 cut(s) 26
DdeI CTNAG 2 cut(s) 176, 419
DpnI GATC 5 cut(s) 24, 30, 352, 367, 424
DpnII GATC 5 cut(s) 22, 28, 350, 365, 422
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
Eco31I GGTCTC 1 cut(s) 284
Eco57I CTGAAG 1 cut(s) 116
FaeI CATG 1 cut(s) 29
FaiI YATR 5 cut(s) 27, 163, 248, 254, 374
FatI CATG 1 cut(s) 25
FbaI TGATCA 1 cut(s) 22
FspBI CTAG 2 cut(s) 342, 348
HaeIII GGCC 4 cut(s) 74, 301, 340, 410
Hin1II CATG 1 cut(s) 29
HindIII AAGCTT 1 cut(s) 13
HinfI GANTC 1 cut(s) 100
HphI GGTGA 1 cut(s) 253
Hpy188I TCNGA 3 cut(s) 85, 177, 420
Hpy188III TCNNGA 2 cut(s) 26, 348
HpyAV CCTTC 1 cut(s) 257
HpyCH4III ACNGT 1 cut(s) 361
HpyCH4V TGCA 3 cut(s) 184, 218, 386
HpyF10VI GCNNNNNNNGC 1 cut(s) 196
HpyF3I CTNAG 2 cut(s) 176, 419
Hsp92II CATG 1 cut(s) 29
Ksp22I TGATCA 1 cut(s) 22
Kzo9I GATC 5 cut(s) 22, 28, 350, 365, 422
LguI GCTCTTC 1 cut(s) 84
LpnPI CCDG 6 cut(s) 43, 54, 88, 172, 315, 321
MaeI CTAG 2 cut(s) 342, 348
MalI GATC 5 cut(s) 24, 30, 352, 367, 424
MboI GATC 5 cut(s) 22, 28, 350, 365, 422
MboII GAAGA 4 cut(s) 98, 101, 109, 155
MluCI AATT 1 cut(s) 224
MnlI CCTC 5 cut(s) 133, 232, 260, 342, 345
MseI TTAA 3 cut(s) 18, 36, 451
MslI CAYNNNNRTG 1 cut(s) 257
MspA1I CMGCKG 1 cut(s) 311
MspCI CTTAAG 1 cut(s) 35
MwoI GCNNNNNNNGC 1 cut(s) 196
NdeII GATC 5 cut(s) 22, 28, 350, 365, 422
NlaIII CATG 1 cut(s) 29
NlaIV GGNNCC 2 cut(s) 73, 271
NmeAIII GCCGAG 1 cut(s) 316
PagI TCATGA 1 cut(s) 25
PciSI GCTCTTC 1 cut(s) 84
PfeI GAWTC 1 cut(s) 100
PspN4I GGNNCC 2 cut(s) 73, 271
PspPI GGNCC 2 cut(s) 72, 408
PvuII CAGCTG 1 cut(s) 311
RseI CAYNNNNRTG 1 cut(s) 257
SapI GCTCTTC 1 cut(s) 84
SaqAI TTAA 3 cut(s) 18, 36, 451
Sau3AI GATC 5 cut(s) 22, 28, 350, 365, 422
Sau96I GGNCC 2 cut(s) 72, 408
SetI ASST 7 cut(s) 12, 17, 96, 114, 243, 313, 329
SfcI CTRYAG 1 cut(s) 5
SmiMI CAYNNNNRTG 1 cut(s) 257
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
Sse9I AATT 1 cut(s) 224
SspMI CTAG 2 cut(s) 342, 348
TaaI ACNGT 1 cut(s) 361
TaqI TCGA 1 cut(s) 425
TasI AATT 1 cut(s) 224
TfiI GAWTC 1 cut(s) 100
Tru1I TTAA 3 cut(s) 18, 36, 451
Tru9I TTAA 3 cut(s) 18, 36, 451
TscAI CASTG 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 389
TspRI CASTG 1 cut(s) 82
Vha464I CTTAAG 1 cut(s) 35
XbaI TCTAGA 1 cut(s) 347
XspI CTAG 2 cut(s) 342, 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.