Rmu_sc0005518.1_g000004

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005518.1
Physical Location & Seq
Forward (+)
7547 .. 8415
869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005518.1_g000004.1.cds

Sequence Viewer

Length: 519 bp
atggaccagcaaggaatatccaacaataaagatcgttcaatcttggagtcgaacgaggccagcgaaacttggctggtaagctttaatgatcatgatcgtcttaagggattacaaggcaaaaacaggagattttctggagacagtgtttccgaagaagagctgaagattcgcaatgagcttgaaatggaagtagaaaaagacttggaggaagaaatcaaagatgggatatgccatcttgctctgagattgcacaggctttatcagcaccaaaaggagagaagtggaagcaaattagcattttgtgaggtgaatataaacatacaaatggaaggaggaaccaagattgaaataaaagagaccaaaaggccagcaccagctgaaagggaaaagagctttcctcctcggcctagttctagatcatctactgtgagatcagttatgaaagtgggtgcaaacacaaagaagtttgattgggccaaaagtctgagatcgagtggtggtaaaggatggaaagtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

172

Amino Acids

19.66

Weight (kDa)

9.05

Isoelectric Point (pI)

64.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014206)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G26290
fragaria_vesca FvH4_1g20030
malus_domestica MD15G1315600.v1.1
prunus_persica Prupe.6G196100_v2.0.a1 Prupe.6G196100_v2.0.a1
pyrus_communis pycom15g27890
rosa_chinensis RchiOBHm_Chr2g0111971
rosa_laevigata RLG00000017942
rosa_multiflora Rmu_sc0005518.1_g000004
rosa_roxburghii Rroxscaffold_2G00131910
rosa_rugosa Rorug02G0177600 Rorug02G0177700
rosa_samantha Rh2AG229900 Rh2BG242700 Rh2CG234000 Rh2DG237700
rosa_wichuraiana Rw2G017800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 182
AflII CTTAAG 1 cut(s) 101
AgsI TTSAA 3 cut(s) 39, 182, 347
AluBI AGCT 5 cut(s) 81, 160, 178, 377, 393
AluI AGCT 5 cut(s) 81, 160, 178, 377, 393
Alw26I GTCTC 2 cut(s) 132, 350
AoxI GGCC 4 cut(s) 57, 365, 404, 474
AspS9I GGNCC 2 cut(s) 4, 474
AsuHPI GGTGA 1 cut(s) 319
AvaII GGWCC 1 cut(s) 4
BccI CCATC 3 cut(s) 215, 240, 501
BclI TGATCA 1 cut(s) 88
BcoDI GTCTC 2 cut(s) 132, 350
BfaI CTAG 2 cut(s) 408, 414
BfrI CTTAAG 1 cut(s) 101
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 2 cut(s) 4, 474
BmiI GGNNCC 1 cut(s) 337
BplI GAGNNNNNCTC 2 cut(s) 382, 414
BpmI CTGGAG 1 cut(s) 156
BsaBI GATNNNNATC 1 cut(s) 93
BsaI GGTCTC 1 cut(s) 350
BsaJI CCNNGG 1 cut(s) 401
BsaXI ACNNNNNCTCC 2 cut(s) 129, 159
Bse3DI GCAATG 1 cut(s) 178
Bse8I GATNNNNATC 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 401
BseGI GGATG 1 cut(s) 512
BseJI GATNNNNATC 1 cut(s) 93
BseMI GCAATG 1 cut(s) 178
BseMII CTCAG 2 cut(s) 233, 476
BseRI GAGGAG 1 cut(s) 390
BshFI GGCC 4 cut(s) 59, 367, 406, 476
BsmAI GTCTC 2 cut(s) 132, 350
BsnI GGCC 4 cut(s) 59, 367, 406, 476
Bso31I GGTCTC 1 cut(s) 350
Bsp143I GATC 6 cut(s) 31, 88, 94, 416, 431, 488
BspANI GGCC 4 cut(s) 59, 367, 406, 476
BspCNI CTCAG 2 cut(s) 234, 477
BspHI TCATGA 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 337
BspQI GCTCTTC 1 cut(s) 150
BspTI CTTAAG 1 cut(s) 101
BspTNI GGTCTC 1 cut(s) 350
BsrDI GCAATG 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 401
BssMI GATC 6 cut(s) 31, 88, 94, 416, 431, 488
Bst4CI ACNGT 2 cut(s) 143, 427
Bst6I CTCTTC 1 cut(s) 150
BstAFI CTTAAG 1 cut(s) 101
BstC8I GCNNGC 2 cut(s) 61, 369
BstDEI CTNAG 2 cut(s) 242, 485
BstF5I GGATG 1 cut(s) 512
BstKTI GATC 6 cut(s) 34, 91, 97, 419, 434, 491
BstMAI GTCTC 2 cut(s) 132, 350
BstMBI GATC 6 cut(s) 31, 88, 94, 416, 431, 488
BstMWI GCNNNNNNNGC 1 cut(s) 262
BsuRI GGCC 4 cut(s) 59, 367, 406, 476
BtsCI GGATG 1 cut(s) 512
BtsIMutI CAGTG 1 cut(s) 148
Cac8I GCNNGC 2 cut(s) 61, 369
CciI TCATGA 1 cut(s) 91
Cfr13I GGNCC 2 cut(s) 4, 474
CviAII CATG 1 cut(s) 92
DdeI CTNAG 2 cut(s) 242, 485
DpnI GATC 6 cut(s) 33, 90, 96, 418, 433, 490
DpnII GATC 6 cut(s) 31, 88, 94, 416, 431, 488
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
Eco31I GGTCTC 1 cut(s) 350
Eco47I GGWCC 1 cut(s) 4
Eco57I CTGAAG 1 cut(s) 182
FaeI CATG 1 cut(s) 95
FaiI YATR 5 cut(s) 93, 229, 314, 320, 440
FatI CATG 1 cut(s) 91
FbaI TGATCA 1 cut(s) 88
FspBI CTAG 2 cut(s) 408, 414
GsuI CTGGAG 1 cut(s) 156
HaeIII GGCC 4 cut(s) 59, 367, 406, 476
Hin1II CATG 1 cut(s) 95
HindIII AAGCTT 1 cut(s) 79
HinfI GANTC 2 cut(s) 47, 166
HphI GGTGA 1 cut(s) 319
Hpy188I TCNGA 3 cut(s) 151, 243, 486
Hpy188III TCNNGA 3 cut(s) 92, 135, 414
HpyAV CCTTC 1 cut(s) 323
HpyCH4III ACNGT 2 cut(s) 143, 427
HpyCH4V TGCA 2 cut(s) 250, 452
HpyF10VI GCNNNNNNNGC 1 cut(s) 262
HpyF3I CTNAG 2 cut(s) 242, 485
Hsp92II CATG 1 cut(s) 95
Ksp22I TGATCA 1 cut(s) 88
Kzo9I GATC 6 cut(s) 31, 88, 94, 416, 431, 488
LguI GCTCTTC 1 cut(s) 150
LpnPI CCDG 8 cut(s) 20, 59, 73, 109, 120, 238, 381, 387
MaeI CTAG 2 cut(s) 408, 414
MalI GATC 6 cut(s) 33, 90, 96, 418, 433, 490
MboI GATC 6 cut(s) 31, 88, 94, 416, 431, 488
MboII GAAGA 4 cut(s) 164, 167, 175, 221
MluCI AATT 1 cut(s) 290
MlyI GAGTC 1 cut(s) 56
MmeI TCCRAC 1 cut(s) 45
MnlI CCTC 6 cut(s) 49, 199, 298, 326, 408, 411
MseI TTAA 3 cut(s) 84, 102, 517
MslI CAYNNNNRTG 1 cut(s) 323
MspA1I CMGCKG 1 cut(s) 377
MspCI CTTAAG 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 262
NdeII GATC 6 cut(s) 31, 88, 94, 416, 431, 488
NlaIII CATG 1 cut(s) 95
NlaIV GGNNCC 1 cut(s) 337
NmeAIII GCCGAG 1 cut(s) 382
PagI TCATGA 1 cut(s) 91
PciSI GCTCTTC 1 cut(s) 150
PcsI WCGNNNNNNNCGW 1 cut(s) 60
PfeI GAWTC 1 cut(s) 166
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
PspN4I GGNNCC 1 cut(s) 337
PspPI GGNCC 2 cut(s) 4, 474
PvuII CAGCTG 1 cut(s) 377
RseI CAYNNNNRTG 1 cut(s) 323
SapI GCTCTTC 1 cut(s) 150
SaqAI TTAA 3 cut(s) 84, 102, 517
Sau3AI GATC 6 cut(s) 31, 88, 94, 416, 431, 488
Sau96I GGNCC 2 cut(s) 4, 474
SchI GAGTC 1 cut(s) 56
SetI ASST 6 cut(s) 83, 162, 180, 309, 379, 395
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 323
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
Sse9I AATT 1 cut(s) 290
SspMI CTAG 2 cut(s) 408, 414
TaaI ACNGT 2 cut(s) 143, 427
TaqI TCGA 2 cut(s) 50, 491
TasI AATT 1 cut(s) 290
TfiI GAWTC 1 cut(s) 166
Tru1I TTAA 3 cut(s) 84, 102, 517
Tru9I TTAA 3 cut(s) 84, 102, 517
TscAI CASTG 1 cut(s) 148
TspDTI ATGAA 1 cut(s) 455
TspRI CASTG 1 cut(s) 148
Vha464I CTTAAG 1 cut(s) 101
VpaK11BI GGWCC 1 cut(s) 4
XbaI TCTAGA 1 cut(s) 413
XspI CTAG 2 cut(s) 408, 414
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.