pycom01g12300

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
13079852 .. 13080113
262 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g12300.2

Sequence Viewer

Length: 222 bp
ATGGGACGAAAGGTTTGGCCTACAGACATAGCTACATACAATGTGATAGTTCAAGGCTTGGGGAAGATGGGTAAATCGGATCTGGCTAGCAGGATTGATGAAGTAAACAAGCTCTTTGAGCAGATGAAGAGTAGTGGAATAAATCCTGATGTTATCACTTTTAATACACTTATTGAAGTTCATAGCAAAGCAGGCCGGCTAAAAGATGCTATAAGTTTTTGA

Protein Analysis

74

Amino Acids

8.08

Weight (kDa)

9.16

Isoelectric Point (pI)

22.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018811)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 87
AgsI TTSAA 2 cut(s) 53, 176
AluBI AGCT 2 cut(s) 32, 112
AluI AGCT 2 cut(s) 32, 112
AlwI GGATC 1 cut(s) 87
AoxI GGCC 2 cut(s) 17, 193
ArsI GACNNNNNNTTYG 1 cut(s) 29
AsuNHI GCTAGC 1 cut(s) 86
BccI CCATC 1 cut(s) 61
BfaI CTAG 1 cut(s) 87
BfmI CTRYAG 1 cut(s) 21
BmsI GCATC 1 cut(s) 196
BmtI GCTAGC 1 cut(s) 90
Bse118I RCCGGY 1 cut(s) 195
BshFI GGCC 2 cut(s) 19, 195
BsiSI CCGG 1 cut(s) 196
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
BsnI GGCC 2 cut(s) 19, 195
Bsp143I GATC 1 cut(s) 79
BspANI GGCC 2 cut(s) 19, 195
BspOI GCTAGC 1 cut(s) 90
BspPI GGATC 1 cut(s) 87
BsrFI RCCGGY 1 cut(s) 195
BssAI RCCGGY 1 cut(s) 195
BssMI GATC 1 cut(s) 79
Bst6I CTCTTC 1 cut(s) 122
BstC8I GCNNGC 3 cut(s) 88, 193, 197
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstMWI GCNNNNNNNGC 2 cut(s) 118, 192
BstSFI CTRYAG 1 cut(s) 21
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
BsuRI GGCC 2 cut(s) 19, 195
Cac8I GCNNGC 3 cut(s) 88, 193, 197
Cfr10I RCCGGY 1 cut(s) 195
CviJI RGCY 7 cut(s) 19, 32, 57, 86, 112, 195, 199
CviKI_1 RGCY 7 cut(s) 19, 32, 57, 86, 112, 195, 199
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eam1104I CTCTTC 1 cut(s) 122
EarI CTCTTC 1 cut(s) 122
FaiI YATR 4 cut(s) 29, 37, 183, 212
FaqI GGGAC 1 cut(s) 18
FspBI CTAG 1 cut(s) 87
HaeIII GGCC 2 cut(s) 19, 195
HapII CCGG 1 cut(s) 196
HpaII CCGG 1 cut(s) 196
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 1 cut(s) 146
Hpy8I GTNNAC 1 cut(s) 106
HpyF10VI GCNNNNNNNGC 2 cut(s) 118, 192
KroI GCCGGC 1 cut(s) 195
KroNI GCCGGC 1 cut(s) 197
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 5 cut(s) 68, 76, 159, 177, 209
LweI GCATC 1 cut(s) 196
MaeI CTAG 1 cut(s) 87
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 2 cut(s) 76, 139
MflI RGATCY 1 cut(s) 79
MroNI GCCGGC 1 cut(s) 195
MseI TTAA 1 cut(s) 162
MspI CCGG 1 cut(s) 196
MwoI GCNNNNNNNGC 2 cut(s) 118, 192
NaeI GCCGGC 1 cut(s) 197
NdeII GATC 1 cut(s) 79
NgoMIV GCCGGC 1 cut(s) 195
NheI GCTAGC 1 cut(s) 86
PdiI GCCGGC 1 cut(s) 197
PsuI RGATCY 1 cut(s) 79
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 1 cut(s) 79
SetI ASST 3 cut(s) 15, 34, 114
SfaNI GCATC 1 cut(s) 196
SfcI CTRYAG 1 cut(s) 21
SgeI CNNG 9 cut(s) 65, 70, 95, 99, 103, 121, 158, 204, 208
SspMI CTAG 1 cut(s) 87
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspDTI ATGAA 3 cut(s) 114, 140, 170
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.