Rh7DG423600

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
59856077 .. 59856403
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG423600.1

Sequence Viewer

Length: 327 bp
ATGGATGATGCATTCGGATTGTTGAGATCGATGGCATTGAAGGGTTTGGAGCCTAATTTGATTTTGTATAATGTGGTGATTATTGGGTTGTGTCGAGAAGGGAGGATGAGTGAGACTAGTCAGGTTGTTGAGGAGATGAAAAGAAAGGGTTTTGTTCCTGATGAGGTGACGAATAATACACTGATTAGTGGGTATTGCAAGCAAGGTAATTTTCACCAAGCACTTGTGTTGCAAGAGGAGATGCGGAGGAATGGCTTGTCTCCGAATGTTGTCACTTATACAGCATTGATCAATGCCATGTGTAAGGCTAGGAATTTGAATCGATGA

Protein Analysis

108

Amino Acids

12.15

Weight (kDa)

8.53

Isoelectric Point (pI)

44.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 14 - 47 1e-09 PPR repeat
PPR_2 PF13041 18 - 62 6.4e-12 PPR repeat family
PPR PF01535 22 - 51 1e-06 PPR repeat
PPR_long PF17177 39 - 107 5e-06 Pentacotripeptide-repeat region of PRORP
PPR_3 PF13812 42 - 100 2.3e-15 Pentatricopeptide repeat domain
PPR_1 PF12854 49 - 82 6.9e-11 PPR repeat
PPR_2 PF13041 53 - 102 7.2e-20 PPR repeat family
PPR PF01535 59 - 86 2.6e-07 PPR repeat
PPR_1 PF12854 84 - 107 1.6e-08 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018811)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 244
AcsI RAATTY 1 cut(s) 313
AgsI TTSAA 2 cut(s) 40, 319
AhlI ACTAGT 1 cut(s) 116
Alw26I GTCTC 2 cut(s) 107, 264
ApoI RAATTY 1 cut(s) 313
AsuHPI GGTGA 3 cut(s) 88, 178, 206
BccI CCATC 1 cut(s) 25
BclI TGATCA 1 cut(s) 288
BcoDI GTCTC 2 cut(s) 107, 264
BcuI ACTAGT 1 cut(s) 116
BfaI CTAG 2 cut(s) 117, 309
BmiI GGNNCC 1 cut(s) 51
BmsI GCATC 1 cut(s) 231
Bsa29I ATCGAT 2 cut(s) 29, 322
BsaXI ACNNNNNCTCC 2 cut(s) 94, 124
BseCI ATCGAT 2 cut(s) 29, 322
BseGI GGATG 2 cut(s) 10, 111
BseRI GAGGAG 2 cut(s) 146, 251
BshVI ATCGAT 2 cut(s) 29, 322
BsmAI GTCTC 2 cut(s) 107, 264
BsmI GAATGC 1 cut(s) 11
Bsp143I GATC 2 cut(s) 26, 288
BspACI CCGC 1 cut(s) 244
BspDI ATCGAT 2 cut(s) 29, 322
BspLI GGNNCC 1 cut(s) 51
BssMI GATC 2 cut(s) 26, 288
BstC8I GCNNGC 1 cut(s) 200
BstF5I GGATG 2 cut(s) 10, 111
BstKTI GATC 2 cut(s) 29, 291
BstMAI GTCTC 2 cut(s) 107, 264
BstMBI GATC 2 cut(s) 26, 288
Bsu15I ATCGAT 2 cut(s) 29, 322
BsuTUI ATCGAT 2 cut(s) 29, 322
BtsCI GGATG 2 cut(s) 10, 111
BtsIMutI CAGTG 1 cut(s) 179
Cac8I GCNNGC 1 cut(s) 200
ClaI ATCGAT 2 cut(s) 29, 322
CviAII CATG 1 cut(s) 298
CviJI RGCY 3 cut(s) 52, 255, 308
CviKI_1 RGCY 3 cut(s) 52, 255, 308
DpnI GATC 2 cut(s) 28, 290
DpnII GATC 2 cut(s) 26, 288
EcoT22I ATGCAT 1 cut(s) 13
FaeI CATG 1 cut(s) 301
FaiI YATR 3 cut(s) 69, 279, 299
FatI CATG 1 cut(s) 297
FbaI TGATCA 1 cut(s) 288
FokI GGATG 2 cut(s) 17, 118
FspBI CTAG 2 cut(s) 117, 309
Hin1II CATG 1 cut(s) 301
HinfI GANTC 1 cut(s) 319
HphI GGTGA 3 cut(s) 88, 178, 206
Hpy188I TCNGA 2 cut(s) 17, 264
Hpy188III TCNNGA 2 cut(s) 95, 158
HpyAV CCTTC 2 cut(s) 34, 92
HpyCH4V TGCA 3 cut(s) 11, 198, 232
Hsp92II CATG 1 cut(s) 301
Ksp22I TGATCA 1 cut(s) 288
Kzo9I GATC 2 cut(s) 26, 288
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 2 cut(s) 107, 171
LweI GCATC 1 cut(s) 231
MaeI CTAG 2 cut(s) 117, 309
MaeIII GTNAC 2 cut(s) 166, 271
MalI GATC 2 cut(s) 28, 290
MboI GATC 2 cut(s) 26, 288
MluCI AATT 3 cut(s) 55, 208, 313
MnlI CCTC 5 cut(s) 96, 124, 157, 229, 240
Mph1103I ATGCAT 1 cut(s) 13
Mva1269I GAATGC 1 cut(s) 11
NdeII GATC 2 cut(s) 26, 288
NlaIII CATG 1 cut(s) 301
NlaIV GGNNCC 1 cut(s) 51
NmuCI GTSAC 2 cut(s) 166, 271
NsiI ATGCAT 1 cut(s) 13
PctI GAATGC 1 cut(s) 11
PfeI GAWTC 1 cut(s) 319
PspN4I GGNNCC 1 cut(s) 51
Sau3AI GATC 2 cut(s) 26, 288
SetI ASST 3 cut(s) 126, 168, 208
SfaNI GCATC 1 cut(s) 231
SpeI ACTAGT 1 cut(s) 116
Sse9I AATT 3 cut(s) 55, 208, 313
SsiI CCGC 1 cut(s) 244
SspMI CTAG 2 cut(s) 117, 309
TaqI TCGA 3 cut(s) 29, 94, 322
TasI AATT 3 cut(s) 55, 208, 313
TfiI GAWTC 1 cut(s) 319
TscAI CASTG 1 cut(s) 186
TseFI GTSAC 2 cut(s) 166, 271
Tsp45I GTSAC 2 cut(s) 166, 271
TspDTI ATGAA 1 cut(s) 152
TspRI CASTG 1 cut(s) 186
XapI RAATTY 1 cut(s) 313
XspI CTAG 2 cut(s) 117, 309
Zsp2I ATGCAT 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.