Rroxscaffold_7G00205970

Pentacotripeptide-repeat region of PRORP

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
55637625 .. 55637792
168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00205970.1

Sequence Viewer

Length: 168 bp
ATGTCTGCCGAGTATGATACGTCGATTGATGCTTATTGTAAGTTGAATGGGATAGAGAAGAGGTGTTTCGGATTATTGAGATCAATGGAATTGAAGGGTTTGGATAAAAATGGGATTTCTTACTATATGGTTGTGGATGGATTGTGTCGCAAAGGAAGGATGAACTAG

Protein Analysis

55

Amino Acids

6.26

Weight (kDa)

8.52

Isoelectric Point (pI)

36.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018811)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 46, 94
BccI CCATC 1 cut(s) 131
BfaI CTAG 1 cut(s) 166
BmsI GCATC 1 cut(s) 19
BseGI GGATG 2 cut(s) 142, 165
Bsp143I GATC 1 cut(s) 80
BssMI GATC 1 cut(s) 80
Bst6I CTCTTC 1 cut(s) 53
BstF5I GGATG 2 cut(s) 142, 165
BstKTI GATC 1 cut(s) 83
BstMBI GATC 1 cut(s) 80
BtsCI GGATG 2 cut(s) 142, 165
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
Eam1104I CTCTTC 1 cut(s) 53
EarI CTCTTC 1 cut(s) 53
FaiI YATR 3 cut(s) 15, 126, 128
FokI GGATG 1 cut(s) 149
FspBI CTAG 1 cut(s) 166
Hpy188I TCNGA 1 cut(s) 71
Hpy99I CGWCG 1 cut(s) 25
HpyAV CCTTC 2 cut(s) 88, 150
HpyCH4IV ACGT 1 cut(s) 20
HpySE526I ACGT 1 cut(s) 20
Kzo9I GATC 1 cut(s) 80
LweI GCATC 1 cut(s) 19
MaeI CTAG 1 cut(s) 166
MaeII ACGT 1 cut(s) 20
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MboII GAAGA 1 cut(s) 70
MluCI AATT 1 cut(s) 89
MnlI CCTC 1 cut(s) 54
NdeII GATC 1 cut(s) 80
NmeAIII GCCGAG 1 cut(s) 34
Sau3AI GATC 1 cut(s) 80
SetI ASST 2 cut(s) 23, 65
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 1 cut(s) 22
Sse9I AATT 1 cut(s) 89
SspMI CTAG 1 cut(s) 166
TaiI ACGT 1 cut(s) 23
TaqI TCGA 1 cut(s) 23
TasI AATT 1 cut(s) 89
XspI CTAG 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.