pycom02g20480

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Forward (+)
18578683 .. 18579005
323 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g20480.3

Sequence Viewer

Length: 237 bp
ATGAAGAGATCAACTTCAACAGGGAGATTAGTTTCTCAAGGTATGGAAAGGAAAAGAATTCTTAGTGTAAAAATCCCCCAATTTCTACTTCGCTTTTGTATACCATATTATATACCCAAAAAGAGAGACCCTGATTGGCTTGTTAGAGGAGGTTTGAGTTCAAATCTTGTGTACGAGAATTGTTTAATTAAAAAAATTCTTACACGGTTATTATACTTGAAAAAGCATAAACTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.25

Weight (kDa)

10.53

Isoelectric Point (pI)

39.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 100
AcsI RAATTY 2 cut(s) 57, 195
AfaI GTAC 1 cut(s) 173
AgsI TTSAA 3 cut(s) 18, 162, 220
AjuI GAANNNNNNNTTGG 2 cut(s) 72, 104
Alw26I GTCTC 1 cut(s) 120
ApoI RAATTY 2 cut(s) 57, 195
BcoDI GTCTC 1 cut(s) 120
BfmI CTRYAG 1 cut(s) 233
BpuEI CTTGAG 1 cut(s) 21
BsaI GGTCTC 1 cut(s) 120
BseRI GAGGAG 1 cut(s) 162
BsmAI GTCTC 1 cut(s) 120
Bso31I GGTCTC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 8
BspTNI GGTCTC 1 cut(s) 120
BssMI GATC 1 cut(s) 8
BssNAI GTATAC 1 cut(s) 101
Bst1107I GTATAC 1 cut(s) 101
Bst4CI ACNGT 1 cut(s) 207
BstDEI CTNAG 1 cut(s) 62
BstKTI GATC 1 cut(s) 11
BstMAI GTCTC 1 cut(s) 120
BstMBI GATC 1 cut(s) 8
BstSFI CTRYAG 1 cut(s) 233
BstZ17I GTATAC 1 cut(s) 101
Csp6I GTAC 1 cut(s) 172
CviJI RGCY 1 cut(s) 139
CviKI_1 RGCY 1 cut(s) 139
CviQI GTAC 1 cut(s) 172
DdeI CTNAG 1 cut(s) 62
DpnI GATC 1 cut(s) 10
DpnII GATC 1 cut(s) 8
Eco31I GGTCTC 1 cut(s) 120
EcoRI GAATTC 1 cut(s) 57
FaiI YATR 8 cut(s) 44, 101, 106, 111, 113, 214, 228, 235
FblI GTMKAC 1 cut(s) 100
Hpy166II GTNNAC 2 cut(s) 101, 172
Hpy8I GTNNAC 2 cut(s) 101, 172
HpyCH4III ACNGT 1 cut(s) 207
HpyF3I CTNAG 1 cut(s) 62
Kzo9I GATC 1 cut(s) 8
LpnPI CCDG 2 cut(s) 6, 144
MalI GATC 1 cut(s) 10
MboI GATC 1 cut(s) 8
MboII GAAGA 1 cut(s) 16
MluCI AATT 5 cut(s) 57, 80, 178, 186, 195
MnlI CCTC 2 cut(s) 140, 143
MseI TTAA 2 cut(s) 185, 189
NdeII GATC 1 cut(s) 8
PacI TTAATTAA 1 cut(s) 189
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
SaqAI TTAA 2 cut(s) 185, 189
Sau3AI GATC 1 cut(s) 8
SetI ASST 2 cut(s) 43, 154
SfcI CTRYAG 1 cut(s) 233
SgeI CNNG 8 cut(s) 33, 50, 143, 152, 179, 187, 216, 229
SmlI CTYRAG 1 cut(s) 36
SmoI CTYRAG 1 cut(s) 36
Sse9I AATT 5 cut(s) 57, 80, 178, 186, 195
TaaI ACNGT 1 cut(s) 207
TasI AATT 5 cut(s) 57, 80, 178, 186, 195
Tru1I TTAA 2 cut(s) 185, 189
Tru9I TTAA 2 cut(s) 185, 189
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 2 cut(s) 57, 195
XmiI GTMKAC 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.