pycom03g05250

Photosystem I psaA/psaB protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Forward (+)
4069404 .. 4069967
564 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g05250.2

Sequence Viewer

Length: 276 bp
ATGGGGTGGGCGGGTTATCAAGTACATCTCTCTTTACCTATTAACCAATTTCTAAATGTTGTAGTAGATCCTAAAGAGATCCCACTTTCTCCAACCCCATTTTTAACCTTTAATTGGTTAAAATATGCGGAATTTCTTACTTTTCGTGGAGGATTAGATTCATTAACTGGGGGTCTATGGCTAACCGATATTGCACACCATCATTTAGCTATTGCAATTCTTTTCCTGATAGCAGGTCACATGTATAGGACCAACTGGGCATTGGTCATGTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.34

Weight (kDa)

6.48

Isoelectric Point (pI)

24.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 274
Acc36I ACCTGC 1 cut(s) 224
AciI CCGC 2 cut(s) 11, 128
AclWI GGATC 2 cut(s) 62, 73
AcsI RAATTY 1 cut(s) 131
AfaI GTAC 1 cut(s) 24
AfiI CCNNNNNNNGG 1 cut(s) 114
AflIII ACRYGT 1 cut(s) 240
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
AlwI GGATC 2 cut(s) 62, 73
ApoI RAATTY 1 cut(s) 131
AspS9I GGNCC 1 cut(s) 249
AvaII GGWCC 1 cut(s) 249
BccI CCATC 1 cut(s) 207
BfuAI ACCTGC 1 cut(s) 224
Bme18I GGWCC 1 cut(s) 249
BmgT120I GGNCC 1 cut(s) 249
BmrI ACTGGG 2 cut(s) 177, 265
BmuI ACTGGG 2 cut(s) 177, 265
Bsc4I CCNNNNNNNGG 1 cut(s) 114
Bse1I ACTGG 2 cut(s) 172, 260
BseLI CCNNNNNNNGG 1 cut(s) 114
BseNI ACTGG 2 cut(s) 172, 260
BslI CCNNNNNNNGG 1 cut(s) 114
Bsp143I GATC 2 cut(s) 67, 78
BspACI CCGC 2 cut(s) 11, 128
BspMI ACCTGC 1 cut(s) 224
BspPI GGATC 2 cut(s) 62, 73
BsrI ACTGG 2 cut(s) 172, 260
BssMI GATC 2 cut(s) 67, 78
BstKTI GATC 2 cut(s) 70, 81
BstMBI GATC 2 cut(s) 67, 78
BstNSI RCATGY 1 cut(s) 244
BstX2I RGATCY 2 cut(s) 67, 78
BstYI RGATCY 2 cut(s) 67, 78
BveI ACCTGC 1 cut(s) 224
Cfr13I GGNCC 1 cut(s) 249
Csp6I GTAC 1 cut(s) 23
CviAII CATG 2 cut(s) 241, 268
CviJI RGCY 2 cut(s) 181, 209
CviKI_1 RGCY 2 cut(s) 181, 209
CviQI GTAC 1 cut(s) 23
DpnI GATC 2 cut(s) 69, 80
DpnII GATC 2 cut(s) 67, 78
Eco47I GGWCC 1 cut(s) 249
FaeI CATG 2 cut(s) 244, 271
FaiI YATR 6 cut(s) 126, 178, 242, 246, 269, 274
FatI CATG 2 cut(s) 240, 267
FauI CCCGC 1 cut(s) 4
Hin1II CATG 2 cut(s) 244, 271
HinfI GANTC 1 cut(s) 158
Hpy188III TCNNGA 1 cut(s) 226
HpyCH4V TGCA 2 cut(s) 194, 215
Hsp92II CATG 2 cut(s) 244, 271
Kzo9I GATC 2 cut(s) 67, 78
LpnPI CCDG 4 cut(s) 153, 219, 239, 241
MaeIII GTNAC 1 cut(s) 236
MalI GATC 2 cut(s) 69, 80
MboI GATC 2 cut(s) 67, 78
MflI RGATCY 2 cut(s) 67, 78
MluCI AATT 4 cut(s) 47, 112, 131, 216
MmeI TCCRAC 1 cut(s) 116
MnlI CCTC 1 cut(s) 143
MseI TTAA 5 cut(s) 42, 104, 111, 119, 164
NdeII GATC 2 cut(s) 67, 78
NlaIII CATG 2 cut(s) 244, 271
NmuCI GTSAC 1 cut(s) 236
NspI RCATGY 1 cut(s) 244
PciI ACATGT 1 cut(s) 240
PfeI GAWTC 1 cut(s) 158
PscI ACATGT 1 cut(s) 240
PsiI TTATAA 1 cut(s) 274
PspPI GGNCC 1 cut(s) 249
PsuI RGATCY 2 cut(s) 67, 78
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
SaqAI TTAA 5 cut(s) 42, 104, 111, 119, 164
Sau3AI GATC 2 cut(s) 67, 78
Sau96I GGNCC 1 cut(s) 249
SetI ASST 4 cut(s) 40, 110, 211, 238
SgeI CNNG 8 cut(s) 24, 32, 158, 180, 238, 246, 253, 268
SinI GGWCC 1 cut(s) 249
Sse9I AATT 4 cut(s) 47, 112, 131, 216
SsiI CCGC 2 cut(s) 11, 128
TasI AATT 4 cut(s) 47, 112, 131, 216
TatI WGTACW 1 cut(s) 22
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 5 cut(s) 42, 104, 111, 119, 164
Tru9I TTAA 5 cut(s) 42, 104, 111, 119, 164
TseFI GTSAC 1 cut(s) 236
Tsp45I GTSAC 1 cut(s) 236
TspDTI ATGAA 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 249
XapI RAATTY 1 cut(s) 131
XceI RCATGY 1 cut(s) 244
XcmI CCANNNNNNNNNTGG 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.