Rh4AG120200

PsaA and PsaB bind P700, the primary electron donor of photosystem I (PSI), as well as the electron acceptors A0, A1 and FX. PSI is a plastocyanin-ferredoxin oxidoreductase, converting photonic excitation into a charge separation, which transfers an electron from the donor P700 chlorophyll pair to the spectroscopically characterized acceptors A0, A1, FX, FA and FB in turn. Oxidized P700 is reduced on the lumenal side of the thylakoid membrane by plastocyanin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0008317
Physical Location & Seq
Reverse (-)
25952261 .. 25953322
1062 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG120200.1

Sequence Viewer

Length: 399 bp
ATGATTATTCGTTCGCCGGAACTAGAAGTTAAAATTTTGATAGATAGGGATCCAGTAAAAACTTCTTTCGAGGAATGGGCCAGACCCGGTCATTTCTCAAGAGCAATAGCTAAGGGGCCTGATACTACCACTTGGATCTGGAACCTACACGCTGATGCTCACGATTTCGATAGCCATACCAGTGATTTGGAGGAGATCTCTCGAAAAGTATTTAGTGCCCATTTTGGTCAACTCTCCATCATCTTTCTTTGGCTGAGTGGTATGTATTTCCACGGTGCTCATTTTTCCAATTATGAAGCATGGCTAAGTGATCCTACTCACATTGGACCTAGTGCCCAGGTGGTTTGGCCAATAGTGGGTCAAGAAATATTGAATGATGATGTAGGCTGGGGTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00195 ko01100 map00195 map01100
Pfam Domains
Protein Families
PsaA_PsaB

Protein Analysis

132

Amino Acids

15.09

Weight (kDa)

5.16

Isoelectric Point (pI)

31.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsaA_PsaB PF00223 32 - 128 9.6e-45 Photosystem I psaA/psaB protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 44, 57, 143, 305
AcoI YGGCCR 1 cut(s) 347
AcsI RAATTY 1 cut(s) 33
AfiI CCNNNNNNNGG 1 cut(s) 356
AgsI TTSAA 1 cut(s) 373
AjnI CCWGG 1 cut(s) 336
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
Alw21I GWGCWC 1 cut(s) 280
AlwI GGATC 4 cut(s) 44, 57, 143, 305
AoxI GGCC 3 cut(s) 78, 116, 347
ApoI RAATTY 1 cut(s) 33
AspS9I GGNCC 3 cut(s) 78, 116, 326
AsuC2I CCSGG 1 cut(s) 87
AvaII GGWCC 1 cut(s) 326
BaeGI GKGCMC 2 cut(s) 220, 337
BalI TGGCCA 1 cut(s) 349
BamHI GGATCC 1 cut(s) 49
Bbv12I GWGCWC 1 cut(s) 280
BccI CCATC 1 cut(s) 245
BciT130I CCWGG 1 cut(s) 338
BcnI CCSGG 1 cut(s) 87
BfaI CTAG 2 cut(s) 23, 330
BglII AGATCT 1 cut(s) 195
Bme1390I CCNGG 2 cut(s) 87, 338
Bme18I GGWCC 1 cut(s) 326
BmgT120I GGNCC 3 cut(s) 78, 116, 326
BmiI GGNNCC 3 cut(s) 51, 117, 143
BmrFI CCNGG 2 cut(s) 87, 338
BmsI GCATC 1 cut(s) 145
BplI GAGNNNNNCTC 2 cut(s) 182, 214
Bpu10I CCTNAGC 1 cut(s) 111
BpuEI CTTGAG 1 cut(s) 82
BpuMI CCSGG 1 cut(s) 87
BsaBI GATNNNNATC 1 cut(s) 48
BsaJI CCNNGG 2 cut(s) 271, 336
Bsc4I CCNNNNNNNGG 1 cut(s) 356
Bse1I ACTGG 2 cut(s) 53, 180
Bse8I GATNNNNATC 1 cut(s) 48
BseBI CCWGG 1 cut(s) 338
BseDI CCNNGG 2 cut(s) 271, 336
BseJI GATNNNNATC 1 cut(s) 48
BseLI CCNNNNNNNGG 1 cut(s) 356
BseMII CTCAG 1 cut(s) 245
BseNI ACTGG 2 cut(s) 53, 180
BseRI GAGGAG 1 cut(s) 206
BseSI GKGCMC 2 cut(s) 220, 337
BseYI CCCAGC 1 cut(s) 387
BshFI GGCC 3 cut(s) 80, 118, 349
BsiHKAI GWGCWC 1 cut(s) 280
BsiSI CCGG 2 cut(s) 17, 87
BslI CCNNNNNNNGG 1 cut(s) 356
BsnI GGCC 3 cut(s) 80, 118, 349
Bsp1286I GDGCHC 3 cut(s) 220, 280, 337
Bsp143I GATC 4 cut(s) 49, 135, 195, 310
BspANI GGCC 3 cut(s) 80, 118, 349
BspCNI CTCAG 1 cut(s) 246
BspLI GGNNCC 3 cut(s) 51, 117, 143
BspPI GGATC 4 cut(s) 44, 57, 143, 305
BsrI ACTGG 2 cut(s) 53, 180
BssECI CCNNGG 2 cut(s) 271, 336
BssMI GATC 4 cut(s) 49, 135, 195, 310
Bst2UI CCWGG 1 cut(s) 338
Bst4CI ACNGT 1 cut(s) 275
BstDEI CTNAG 3 cut(s) 111, 254, 305
BstDSI CCRYGG 1 cut(s) 271
BstKTI GATC 4 cut(s) 52, 138, 198, 313
BstMBI GATC 4 cut(s) 49, 135, 195, 310
BstNI CCWGG 1 cut(s) 338
BstSCI CCNGG 2 cut(s) 85, 336
BstSLI GKGCMC 2 cut(s) 220, 337
BstX2I RGATCY 3 cut(s) 49, 135, 195
BstXI CCANNNNNNTGG 1 cut(s) 187
BstYI RGATCY 3 cut(s) 49, 135, 195
BsuRI GGCC 3 cut(s) 80, 118, 349
BtgI CCRYGG 1 cut(s) 271
BtsIMutI CAGTG 1 cut(s) 187
Cfr13I GGNCC 3 cut(s) 78, 116, 326
CviAII CATG 1 cut(s) 300
CviJI RGCY 8 cut(s) 80, 110, 118, 174, 253, 304, 349, 387
CviKI_1 RGCY 8 cut(s) 80, 110, 118, 174, 253, 304, 349, 387
DdeI CTNAG 3 cut(s) 111, 254, 305
DpnI GATC 4 cut(s) 51, 137, 197, 312
DpnII GATC 4 cut(s) 49, 135, 195, 310
EaeI YGGCCR 1 cut(s) 347
Eco47I GGWCC 1 cut(s) 326
EcoO109I RGGNCCY 1 cut(s) 116
EcoRII CCWGG 1 cut(s) 336
FaeI CATG 1 cut(s) 303
FaiI YATR 4 cut(s) 177, 263, 294, 301
FatI CATG 1 cut(s) 299
FspBI CTAG 2 cut(s) 23, 330
GsaI CCCAGC 1 cut(s) 391
HaeIII GGCC 3 cut(s) 80, 118, 349
HapII CCGG 2 cut(s) 17, 87
Hin1II CATG 1 cut(s) 303
HincII GTYRAC 1 cut(s) 230
HindII GTYRAC 1 cut(s) 230
HpaII CCGG 2 cut(s) 17, 87
Hpy166II GTNNAC 1 cut(s) 230
Hpy188I TCNGA 1 cut(s) 398
Hpy188III TCNNGA 5 cut(s) 99, 139, 161, 201, 362
Hpy8I GTNNAC 1 cut(s) 230
HpyCH4III ACNGT 1 cut(s) 275
HpyF3I CTNAG 3 cut(s) 111, 254, 305
Hsp92II CATG 1 cut(s) 303
Kzo9I GATC 4 cut(s) 49, 135, 195, 310
LweI GCATC 1 cut(s) 145
MaeI CTAG 2 cut(s) 23, 330
MalI GATC 4 cut(s) 51, 137, 197, 312
MboI GATC 4 cut(s) 49, 135, 195, 310
MflI RGATCY 3 cut(s) 49, 135, 195
MhlI GDGCHC 3 cut(s) 220, 280, 337
MlsI TGGCCA 1 cut(s) 349
MluCI AATT 2 cut(s) 33, 289
MluNI TGGCCA 1 cut(s) 349
MnlI CCTC 2 cut(s) 64, 184
Mox20I TGGCCA 1 cut(s) 349
MscI TGGCCA 1 cut(s) 349
MseI TTAA 1 cut(s) 30
MslI CAYNNNNRTG 2 cut(s) 153, 180
Msp20I TGGCCA 1 cut(s) 349
MspI CCGG 2 cut(s) 17, 87
MspR9I CCNGG 2 cut(s) 87, 338
MvaI CCWGG 1 cut(s) 338
NciI CCSGG 1 cut(s) 87
NdeII GATC 4 cut(s) 49, 135, 195, 310
NlaIII CATG 1 cut(s) 303
NlaIV GGNNCC 3 cut(s) 51, 117, 143
PflFI GACNNNGTC 1 cut(s) 87
Psp6I CCWGG 1 cut(s) 336
PspFI CCCAGC 1 cut(s) 387
PspGI CCWGG 1 cut(s) 336
PspN4I GGNNCC 3 cut(s) 51, 117, 143
PspPI GGNCC 3 cut(s) 78, 116, 326
PsuI RGATCY 3 cut(s) 49, 135, 195
PsyI GACNNNGTC 1 cut(s) 87
RseI CAYNNNNRTG 2 cut(s) 153, 180
SaqAI TTAA 1 cut(s) 30
Sau3AI GATC 4 cut(s) 49, 135, 195, 310
Sau96I GGNCC 3 cut(s) 78, 116, 326
ScrFI CCNGG 2 cut(s) 87, 338
SduI GDGCHC 3 cut(s) 220, 280, 337
SetI ASST 4 cut(s) 112, 147, 331, 342
SfaNI GCATC 1 cut(s) 145
SinI GGWCC 1 cut(s) 326
SmiMI CAYNNNNRTG 2 cut(s) 153, 180
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
Sse9I AATT 2 cut(s) 33, 289
SspI AATATT 1 cut(s) 369
SspMI CTAG 2 cut(s) 23, 330
StyD4I CCNGG 2 cut(s) 85, 336
TaaI ACNGT 1 cut(s) 275
TaqI TCGA 3 cut(s) 69, 168, 202
TasI AATT 2 cut(s) 33, 289
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TscAI CASTG 1 cut(s) 187
TspDTI ATGAA 1 cut(s) 309
TspRI CASTG 1 cut(s) 187
Tth111I GACNNNGTC 1 cut(s) 87
VpaK11BI GGWCC 1 cut(s) 326
XapI RAATTY 1 cut(s) 33
XspI CTAG 2 cut(s) 23, 330
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.