pycom03g11110
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Forward (+)
10737519 .. 10738328
810 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g11110.2

Sequence Viewer

Length: 225 bp
ATGATCTTGATGGTGCGGTCATGGTTAAATGTTCCCACTTTCTGGTTTTGTTATTTTTTTACCTTCGTGCTGTGGTTTTTTTCTTCATGTGATTCTGTGCTGGAAAATATCAAGGCTTTCTCCTACAATGAATTAAGATCCGCGACGGATAATTTTCATCCGAGTAATAAGATTGGTCAAGGCGGTTTTGGAACTGTATACAAGAATGAGATGTGGTTAGCTTAG

Protein Analysis

75

Amino Acids

8.75

Weight (kDa)

6.52

Isoelectric Point (pI)

58.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 42
AccI GTMKAC 1 cut(s) 198
AccII CGCG 1 cut(s) 143
AciI CCGC 3 cut(s) 16, 141, 183
AclWI GGATC 1 cut(s) 132
AfiI CCNNNNNNNGG 1 cut(s) 42
AluBI AGCT 1 cut(s) 221
AluI AGCT 1 cut(s) 221
AlwI GGATC 1 cut(s) 132
BccI CCATC 1 cut(s) 4
Bsc4I CCNNNNNNNGG 1 cut(s) 42
BseGI GGATG 1 cut(s) 157
BseLI CCNNNNNNNGG 1 cut(s) 42
Bsh1236I CGCG 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 42
Bsp143I GATC 2 cut(s) 3, 137
BspACI CCGC 3 cut(s) 16, 141, 183
BspFNI CGCG 1 cut(s) 143
BspPI GGATC 1 cut(s) 132
BssMI GATC 2 cut(s) 3, 137
BssNAI GTATAC 1 cut(s) 199
Bst1107I GTATAC 1 cut(s) 199
Bst4CI ACNGT 1 cut(s) 196
BstDEI CTNAG 1 cut(s) 222
BstF5I GGATG 1 cut(s) 157
BstFNI CGCG 1 cut(s) 143
BstKTI GATC 2 cut(s) 6, 140
BstMBI GATC 2 cut(s) 3, 137
BstUI CGCG 1 cut(s) 143
BstX2I RGATCY 1 cut(s) 137
BstYI RGATCY 1 cut(s) 137
BstZ17I GTATAC 1 cut(s) 199
BtsCI GGATG 1 cut(s) 157
CviAII CATG 2 cut(s) 21, 87
CviJI RGCY 2 cut(s) 116, 221
CviKI_1 RGCY 2 cut(s) 116, 221
DdeI CTNAG 1 cut(s) 222
DpnI GATC 2 cut(s) 5, 139
DpnII GATC 2 cut(s) 3, 137
FaeI CATG 2 cut(s) 24, 90
FaiI YATR 3 cut(s) 22, 88, 199
FatI CATG 2 cut(s) 20, 86
FblI GTMKAC 1 cut(s) 198
FokI GGATG 1 cut(s) 144
Hin1II CATG 2 cut(s) 24, 90
HinfI GANTC 1 cut(s) 92
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 1 cut(s) 162
Hpy188III TCNNGA 1 cut(s) 7
Hpy8I GTNNAC 1 cut(s) 199
Hpy99I CGWCG 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 73
HpyCH4III ACNGT 1 cut(s) 196
HpyF3I CTNAG 1 cut(s) 222
Hsp92II CATG 2 cut(s) 24, 90
Kzo9I GATC 2 cut(s) 3, 137
LpnPI CCDG 2 cut(s) 28, 86
MalI GATC 2 cut(s) 5, 139
MboI GATC 2 cut(s) 3, 137
MboII GAAGA 1 cut(s) 75
MflI RGATCY 1 cut(s) 137
MluCI AATT 2 cut(s) 131, 151
MseI TTAA 2 cut(s) 26, 134
MvnI CGCG 1 cut(s) 143
NdeII GATC 2 cut(s) 3, 137
NlaIII CATG 2 cut(s) 24, 90
PfeI GAWTC 1 cut(s) 92
PflMI CCANNNNNTGG 1 cut(s) 42
PsuI RGATCY 1 cut(s) 137
SaqAI TTAA 2 cut(s) 26, 134
Sau3AI GATC 2 cut(s) 3, 137
SetI ASST 2 cut(s) 65, 223
Sse9I AATT 2 cut(s) 131, 151
SsiI CCGC 3 cut(s) 16, 141, 183
TaaI ACNGT 1 cut(s) 196
TasI AATT 2 cut(s) 131, 151
TfiI GAWTC 1 cut(s) 92
Tru1I TTAA 2 cut(s) 26, 134
Tru9I TTAA 2 cut(s) 26, 134
TspDTI ATGAA 3 cut(s) 75, 144, 146
TspGWI ACGGA 1 cut(s) 161
Van91I CCANNNNNTGG 1 cut(s) 42
XmiI GTMKAC 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.