RchiOBHm_Chr4g0393401

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
8890730 .. 8890900
171 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36600

Sequence Viewer

Length: 171 bp
ATGCATACCCCCCCACCCCTCCTTTTCTCTCTCCTTTTTTGCTCTTACTATATAAACTTTATAAACATTGTGTTCAGATTAATTTTATTAGTTTTATTTGTTTCTCTTTTGCAAGTTCTATGCAAAAAAGTGTTGCTGTCATTTTTTTGCCACTGTTCGTTTGTCTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.62

Weight (kDa)

8.86

Isoelectric Point (pI)

42.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 62
AseI ATTAAT 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 155
BtsIMutI CAGTG 1 cut(s) 151
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 5 cut(s) 6, 51, 53, 62, 121
Hpy188I TCNGA 1 cut(s) 77
HpyCH4III ACNGT 1 cut(s) 155
HpyCH4V TGCA 3 cut(s) 4, 112, 123
MluCI AATT 1 cut(s) 81
MnlI CCTC 1 cut(s) 29
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 80, 169
NsiI ATGCAT 1 cut(s) 6
PshBI ATTAAT 1 cut(s) 80
PsiI TTATAA 1 cut(s) 62
SaqAI TTAA 2 cut(s) 80, 169
SgeI CNNG 1 cut(s) 125
Sse9I AATT 1 cut(s) 81
TaaI ACNGT 1 cut(s) 155
TasI AATT 1 cut(s) 81
Tru1I TTAA 2 cut(s) 80, 169
Tru9I TTAA 2 cut(s) 80, 169
TscAI CASTG 1 cut(s) 158
TspRI CASTG 1 cut(s) 158
VspI ATTAAT 1 cut(s) 80
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.