pycom06g19720

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Forward (+)
23044427 .. 23045067
641 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g19720.1

Sequence Viewer

Length: 318 bp
ATGAATAAATATGTCGGTCTCTCTCTCTCTCTCTCTCTCTCTCTCAGAAAAAAAATGCAGAGGACCTTATTCTGGGGAAACATGAAGAGGTACAGGAGGAGAAGGCGTTACCGCAGACTAAGAAATGCGGTTACTAATGGGCAAAACGCGATGGTTTCAATGGGGAAACGTCTTAAGTTTGGGAAAATTCGAGTGACCCCGATGCTACAAATAAAGGTGAAATCGTCGATAATGCTCTTGAAAAAGTTTAGAAATGCTTATGTGGAAATGATGCTTTGTTTTGCTGGACGTGTTATGCACTTGAATAATGGCATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.49

Weight (kDa)

12.0

Isoelectric Point (pI)

43.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 149
AciI CCGC 2 cut(s) 112, 128
AcsI RAATTY 1 cut(s) 186
AfaI GTAC 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 72
AflII CTTAAG 1 cut(s) 173
AflIII ACRYGT 1 cut(s) 289
AgsI TTSAA 3 cut(s) 159, 241, 304
AjiI CACGTC 1 cut(s) 290
Alw26I GTCTC 1 cut(s) 23
ApoI RAATTY 1 cut(s) 186
AspS9I GGNCC 1 cut(s) 63
AsuHPI GGTGA 1 cut(s) 229
AvaII GGWCC 1 cut(s) 63
BccI CCATC 1 cut(s) 145
BcoDI GTCTC 1 cut(s) 23
BfrI CTTAAG 1 cut(s) 173
Bme18I GGWCC 1 cut(s) 63
BmgBI CACGTC 1 cut(s) 290
BmgT120I GGNCC 1 cut(s) 63
BmsI GCATC 2 cut(s) 192, 261
BsaI GGTCTC 1 cut(s) 23
BsaXI ACNNNNNCTCC 2 cut(s) 91, 121
Bsc4I CCNNNNNNNGG 1 cut(s) 72
BseLI CCNNNNNNNGG 1 cut(s) 72
BseMII CTCAG 1 cut(s) 58
BseRI GAGGAG 1 cut(s) 112
Bsh1236I CGCG 1 cut(s) 149
BslI CCNNNNNNNGG 1 cut(s) 72
BsmAI GTCTC 1 cut(s) 23
Bso31I GGTCTC 1 cut(s) 23
BspACI CCGC 2 cut(s) 112, 128
BspCNI CTCAG 1 cut(s) 57
BspFNI CGCG 1 cut(s) 149
BspTI CTTAAG 1 cut(s) 173
BspTNI GGTCTC 1 cut(s) 23
Bst6I CTCTTC 1 cut(s) 80
BstAFI CTTAAG 1 cut(s) 173
BstDEI CTNAG 2 cut(s) 44, 119
BstFNI CGCG 1 cut(s) 149
BstMAI GTCTC 1 cut(s) 23
BstUI CGCG 1 cut(s) 149
BtgZI GCGATG 1 cut(s) 164
BtrI CACGTC 1 cut(s) 290
Cfr13I GGNCC 1 cut(s) 63
Csp6I GTAC 1 cut(s) 91
CviAII CATG 1 cut(s) 82
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 2 cut(s) 44, 119
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
Eco31I GGTCTC 1 cut(s) 23
Eco47I GGWCC 1 cut(s) 63
EcoO109I RGGNCCY 1 cut(s) 63
FaeI CATG 1 cut(s) 85
FaiI YATR 6 cut(s) 12, 83, 261, 296, 314, 316
FatI CATG 1 cut(s) 81
Hin1II CATG 1 cut(s) 85
HphI GGTGA 1 cut(s) 229
Hpy188I TCNGA 1 cut(s) 47
Hpy188III TCNNGA 1 cut(s) 238
Hpy99I CGWCG 1 cut(s) 229
HpyAV CCTTC 1 cut(s) 96
HpyCH4IV ACGT 2 cut(s) 169, 289
HpyCH4V TGCA 2 cut(s) 58, 298
HpyF3I CTNAG 2 cut(s) 44, 119
HpySE526I ACGT 2 cut(s) 169, 289
Hsp92II CATG 1 cut(s) 85
LpnPI CCDG 3 cut(s) 58, 79, 270
LweI GCATC 2 cut(s) 192, 261
MaeII ACGT 2 cut(s) 169, 289
MaeIII GTNAC 3 cut(s) 107, 130, 193
MboII GAAGA 1 cut(s) 97
MluCI AATT 1 cut(s) 186
MnlI CCTC 3 cut(s) 54, 81, 90
MseI TTAA 1 cut(s) 174
MspCI CTTAAG 1 cut(s) 173
MvnI CGCG 1 cut(s) 149
NlaIII CATG 1 cut(s) 85
NmuCI GTSAC 1 cut(s) 193
PpuMI RGGWCCY 1 cut(s) 63
Psp5II RGGWCCY 1 cut(s) 63
PspPI GGNCC 1 cut(s) 63
PspPPI RGGWCCY 1 cut(s) 63
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
SaqAI TTAA 1 cut(s) 174
Sau96I GGNCC 1 cut(s) 63
SetI ASST 5 cut(s) 68, 92, 172, 219, 292
SfaNI GCATC 2 cut(s) 192, 261
SinI GGWCC 1 cut(s) 63
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 1 cut(s) 186
SsiI CCGC 2 cut(s) 112, 128
TaiI ACGT 2 cut(s) 172, 292
TaqI TCGA 2 cut(s) 190, 227
TaqII GACCGA 1 cut(s) 5
TasI AATT 1 cut(s) 186
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseFI GTSAC 1 cut(s) 193
Tsp45I GTSAC 1 cut(s) 193
TspDTI ATGAA 2 cut(s) 17, 98
Vha464I CTTAAG 1 cut(s) 173
VpaK11BI GGWCC 1 cut(s) 63
XapI RAATTY 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.