pycom07g07420

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
6729654 .. 6729920
267 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g07420.1

Sequence Viewer

Length: 267 bp
ATGGCACCTGGTAATGATTTTTATGGGAGTATTCCAGATATCTTTGGTCAAACGGCCAATTTTAAAGTTCTTGGTTTGGGTAGTAATAGGTTCTCAGATGTGATCCCTCCCTCACTCTGTAATCTCTCTTCCATTAGTATCATTGACGTTACAGTCAACAGAATCCAAGGCACTTTACCTCCAAACCTAGGTATTGTCTTTCCAAGTCGAATATTTAGGGGTCGGCCACAACAAATTTACTGGACCTCTTCCTATTTCGTTATCTAA

Protein Analysis

89

Amino Acids

9.69

Weight (kDa)

9.1

Isoelectric Point (pI)

27.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 152
AccB1I GGYRCC 1 cut(s) 4
AclWI GGATC 1 cut(s) 97
AcoI YGGCCR 2 cut(s) 54, 224
AcsI RAATTY 1 cut(s) 234
AfiI CCNNNNNNNGG 1 cut(s) 188
AjnI CCWGG 1 cut(s) 7
AlwI GGATC 1 cut(s) 97
AoxI GGCC 2 cut(s) 54, 224
ApoI RAATTY 1 cut(s) 234
AspA2I CCTAGG 1 cut(s) 187
AspS9I GGNCC 1 cut(s) 243
AvaII GGWCC 1 cut(s) 243
AvrII CCTAGG 1 cut(s) 187
BanI GGYRCC 1 cut(s) 4
BarI GAAGNNNNNNTAC 2 cut(s) 112, 144
BceAI ACGGC 1 cut(s) 69
BciT130I CCWGG 1 cut(s) 9
BfaI CTAG 1 cut(s) 188
BlnI CCTAGG 1 cut(s) 187
Bme1390I CCNGG 1 cut(s) 9
Bme18I GGWCC 1 cut(s) 243
BmgT120I GGNCC 1 cut(s) 243
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 9
BsaJI CCNNGG 2 cut(s) 166, 187
BsaXI ACNNNNNCTCC 2 cut(s) 163, 193
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse1I ACTGG 1 cut(s) 245
BseBI CCWGG 1 cut(s) 9
BseDI CCNNGG 2 cut(s) 166, 187
BseLI CCNNNNNNNGG 1 cut(s) 188
BseMII CTCAG 1 cut(s) 108
BseNI ACTGG 1 cut(s) 245
BshFI GGCC 2 cut(s) 56, 226
BshNI GGYRCC 1 cut(s) 4
BslI CCNNNNNNNGG 1 cut(s) 188
BsnI GGCC 2 cut(s) 56, 226
Bsp143I GATC 1 cut(s) 102
BspANI GGCC 2 cut(s) 56, 226
BspCNI CTCAG 1 cut(s) 107
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 97
BspT107I GGYRCC 1 cut(s) 4
BsrI ACTGG 1 cut(s) 245
BssECI CCNNGG 2 cut(s) 166, 187
BssMI GATC 1 cut(s) 102
BssT1I CCWWGG 2 cut(s) 166, 187
Bst2UI CCWGG 1 cut(s) 9
Bst4CI ACNGT 1 cut(s) 154
Bst6I CTCTTC 2 cut(s) 133, 253
BstDEI CTNAG 1 cut(s) 94
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 9
BstSCI CCNGG 1 cut(s) 7
BsuRI GGCC 2 cut(s) 56, 226
Cfr13I GGNCC 1 cut(s) 243
CsiI ACCWGGT 1 cut(s) 7
CviJI RGCY 2 cut(s) 56, 226
CviKI_1 RGCY 2 cut(s) 56, 226
DdeI CTNAG 1 cut(s) 94
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
DraI TTTAAA 1 cut(s) 64
DrdI GACNNNNNNGTC 1 cut(s) 152
DseDI GACNNNNNNGTC 1 cut(s) 152
EaeI YGGCCR 2 cut(s) 54, 224
Eam1104I CTCTTC 2 cut(s) 133, 253
EarI CTCTTC 2 cut(s) 133, 253
Eco130I CCWWGG 2 cut(s) 166, 187
Eco32I GATATC 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 243
EcoRII CCWGG 1 cut(s) 7
EcoRV GATATC 1 cut(s) 40
EcoT14I CCWWGG 2 cut(s) 166, 187
ErhI CCWWGG 2 cut(s) 166, 187
FaiI YATR 1 cut(s) 24
FspBI CTAG 1 cut(s) 188
HaeIII GGCC 2 cut(s) 56, 226
HincII GTYRAC 1 cut(s) 157
HindII GTYRAC 1 cut(s) 157
HinfI GANTC 1 cut(s) 162
Hpy166II GTNNAC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 1 cut(s) 157
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4IV ACGT 1 cut(s) 147
HpyF3I CTNAG 1 cut(s) 94
HpySE526I ACGT 1 cut(s) 147
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 3 cut(s) 21, 48, 226
MabI ACCWGGT 1 cut(s) 7
MaeI CTAG 1 cut(s) 188
MaeII ACGT 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 148
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 2 cut(s) 120, 240
MluCI AATT 2 cut(s) 58, 234
MnlI CCTC 4 cut(s) 117, 121, 189, 256
MseI TTAA 1 cut(s) 63
MspR9I CCNGG 1 cut(s) 9
MvaI CCWGG 1 cut(s) 9
NdeII GATC 1 cut(s) 102
NlaIV GGNNCC 1 cut(s) 6
PfeI GAWTC 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 7
PspGI CCWGG 1 cut(s) 7
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 243
SaqAI TTAA 1 cut(s) 63
Sau3AI GATC 1 cut(s) 102
Sau96I GGNCC 1 cut(s) 243
ScrFI CCNGG 1 cut(s) 9
SetI ASST 7 cut(s) 10, 92, 150, 181, 189, 193, 248
SexAI ACCWGGT 1 cut(s) 7
SgeI CNNG 8 cut(s) 20, 21, 47, 83, 179, 200, 216, 253
SinI GGWCC 1 cut(s) 243
Sse9I AATT 2 cut(s) 58, 234
SspI AATATT 1 cut(s) 213
SspMI CTAG 1 cut(s) 188
StyD4I CCNGG 1 cut(s) 7
StyI CCWWGG 2 cut(s) 166, 187
TaaI ACNGT 1 cut(s) 154
TaiI ACGT 1 cut(s) 150
TaqI TCGA 1 cut(s) 208
TasI AATT 2 cut(s) 58, 234
TfiI GAWTC 1 cut(s) 162
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
VpaK11BI GGWCC 1 cut(s) 243
XapI RAATTY 1 cut(s) 234
XmaJI CCTAGG 1 cut(s) 187
XspI CTAG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.