Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0016960

Physical Location & Seq

Genomic Coordinates Forward (+)

65797014 .. 65797851

Gene Structure 838 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00046570.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 537 bp

ATGCACAGTCTTATTGAATGTGCTTTTGGCAAATCAATACTCCTACAGTTTAACCTCGTATTCACTCCTGGACCTAGACTTATGGTACGGATGATTTGGTTAAAGATACAGATCGAGCGTGAAAACCCAGAAAGGGATAGACCTGATAGAAATGGTGCATTTGGAAATAAAGAGCTTGACCTATCTAATTCTGAGCGTTGCACTCCAAGTTATCGTCTTCTGCCAAAGAATTATCCAATACCTTCTGCTAGCCAAAGAACAGAGCTTGGTTCTGAAGTACTAAATGGTCATTGGGTGTCTATTACTCTTGGACACGAGGATTATTCTTTTAAAACATGCGCAAAAGCATTAGAGAAGGTGGAGGACAAGTCCAATGTTTCCAGGGAAAGTGTTCTCCATCAAATAAGTGAGGCAAAGGCATTGCTTGCTTCGCCAGATAAGAAATCCGAACCATTGGCTTTTATCATTAATGAGAATTTGCTCGCTTACGCCTTAGAGGTAGAAGTTCAGGACCTCTTTTATCATTCTTTTGGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000118 GO:0000122 GO:0000785 GO:0001101 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005694 GO:0006325 GO:0006355 GO:0006357 GO:0006464 GO:0006476 GO:0006807 GO:0006996 GO:0008150 GO:0008152 GO:0009719 GO:0009725 GO:0009737 GO:0009889 GO:0009890 GO:0009892 GO:0009987 GO:0010033 GO:0010468 GO:0010556 GO:0010558 GO:0010605 GO:0010629 GO:0016043 GO:0016569 GO:0016570 GO:0016575 GO:0019219 GO:0019222 GO:0019538 GO:0031323 GO:0031324 GO:0031326 GO:0031327 GO:0031974 GO:0031981 GO:0032991 GO:0033993 GO:0035601 GO:0036211 GO:0042221 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044446 GO:0044451 GO:0044464 GO:0045892 GO:0045934 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051172 GO:0051252 GO:0051253 GO:0051276 GO:0060255 GO:0065007 GO:0070013 GO:0071704 GO:0071840 GO:0080090 GO:0097305 GO:0098732 GO:1901564 GO:1901700 GO:1902494 GO:1902679 GO:1903506 GO:1903507 GO:2000112 GO:2000113 GO:2001141

KEGG Pathways

Metabolic & Signaling

ko04139 ko04919 ko05016 ko05202 map04139 map04919 map05016 map05202

Pfam Domains

Protein Families

PAH Sin3_corepress Sin3a_C

Protein Analysis

178

Amino Acids

20.23

Weight (kDa)

5.98

Isoelectric Point (pI)

42.53

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Sin3_corepress	PF08295	65 - 115	6.3e-13	Sin3 family co-repressor

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016960)

Species	Orthologous Gene IDs
pyrus_communis	pycom07g07420
rosa_chinensis	RchiOBHm_Chr3g0485381
rosa_multiflora	Rmu_sc0000455.1_g000014 Rmu_sc0003863.1_g000006
rosa_roxburghii	Rroxscaffold_1G00046570 Rroxscaffold_2G00094580 Rroxscaffold_7G00158850 Rroxscaffold_7G00198560
rosa_rugosa	Rorug02G0195600 Rorug06G0009900 Rorug07G0338500
rosa_samantha	Rh6BG316300 Rh6BG316600
rosa_wichuraiana	Rw5G040660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	340
AcsI	RAATTY	1 cut(s)	475
AcuI	CTGAAG	1 cut(s)	294
AfaI	GTAC	2 cut(s)	87, 279
AfiI	CCNNNNNNNGG	1 cut(s)	133
AgsI	TTSAA	1 cut(s)	17
AjnI	CCWGG	2 cut(s)	67, 380
AjuI	GAANNNNNNNTTGG	2 cut(s)	9, 41
AluBI	AGCT	2 cut(s)	175, 265
AluI	AGCT	2 cut(s)	175, 265
ApoI	RAATTY	1 cut(s)	475
AseI	ATTAAT	1 cut(s)	468
Asp700I	GAANNNNTTC	1 cut(s)	390
AspLEI	GCGC	1 cut(s)	341
AspS9I	GGNCC	2 cut(s)	71, 511
AsuNHI	GCTAGC	1 cut(s)	248
AvaII	GGWCC	2 cut(s)	71, 511
BauI	CACGAG	1 cut(s)	314
BbsI	GAAGAC	1 cut(s)	209
BccI	CCATC	1 cut(s)	405
BciT130I	CCWGG	2 cut(s)	69, 382
BfaI	CTAG	2 cut(s)	75, 249
BfmI	CTRYAG	1 cut(s)	44
BmcAI	AGTACT	1 cut(s)	279
Bme1390I	CCNGG	2 cut(s)	69, 382
Bme18I	GGWCC	2 cut(s)	71, 511
BmgT120I	GGNCC	2 cut(s)	71, 511
BmrFI	CCNGG	2 cut(s)	69, 382
BmtI	GCTAGC	1 cut(s)	252
BpiI	GAAGAC	1 cut(s)	209
BsaBI	GATNNNNATC	1 cut(s)	110
BsaJI	CCNNGG	1 cut(s)	381
BsaXI	ACNNNNNCTCC	2 cut(s)	353, 383
Bsc4I	CCNNNNNNNGG	1 cut(s)	133
Bse3DI	GCAATG	1 cut(s)	419
Bse8I	GATNNNNATC	1 cut(s)	110
BseBI	CCWGG	2 cut(s)	69, 382
BseDI	CCNNGG	1 cut(s)	381
BseGI	GGATG	1 cut(s)	96
BseJI	GATNNNNATC	1 cut(s)	110
BseLI	CCNNNNNNNGG	1 cut(s)	133
BseMI	GCAATG	1 cut(s)	419
BseMII	CTCAG	1 cut(s)	183
BslI	CCNNNNNNNGG	1 cut(s)	133
Bsp143I	GATC	1 cut(s)	111
BspCNI	CTCAG	1 cut(s)	184
BspOI	GCTAGC	1 cut(s)	252
BsrDI	GCAATG	1 cut(s)	419
BssECI	CCNNGG	1 cut(s)	381
BssMI	GATC	1 cut(s)	111
BssSI	CACGAG	1 cut(s)	314
Bst2BI	CACGAG	1 cut(s)	314
Bst2UI	CCWGG	2 cut(s)	69, 382
Bst4CI	ACNGT	2 cut(s)	8, 48
BstAPI	GCANNNNNTGC	1 cut(s)	425
BstC8I	GCNNGC	3 cut(s)	250, 426, 483
BstDEI	CTNAG	2 cut(s)	192, 493
BstF5I	GGATG	1 cut(s)	96
BstHHI	GCGC	1 cut(s)	341
BstKTI	GATC	1 cut(s)	114
BstMBI	GATC	1 cut(s)	111
BstMWI	GCNNNNNNNGC	2 cut(s)	425, 430
BstNI	CCWGG	2 cut(s)	69, 382
BstNSI	RCATGY	1 cut(s)	339
BstSCI	CCNGG	2 cut(s)	67, 380
BstSFI	CTRYAG	1 cut(s)	44
BstV2I	GAAGAC	1 cut(s)	209
BtsCI	GGATG	1 cut(s)	96
Cac8I	GCNNGC	3 cut(s)	250, 426, 483
CfoI	GCGC	1 cut(s)	341
Cfr13I	GGNCC	2 cut(s)	71, 511
Csp6I	GTAC	2 cut(s)	86, 278
CviAII	CATG	1 cut(s)	336
CviJI	RGCY	4 cut(s)	175, 252, 265, 458
CviKI_1	RGCY	4 cut(s)	175, 252, 265, 458
CviQI	GTAC	2 cut(s)	86, 278
DdeI	CTNAG	2 cut(s)	192, 493
DpnI	GATC	1 cut(s)	113
DpnII	GATC	1 cut(s)	111
DraI	TTTAAA	1 cut(s)	331
Eco47I	GGWCC	2 cut(s)	71, 511
Eco57I	CTGAAG	1 cut(s)	294
EcoO109I	RGGNCCY	1 cut(s)	511
EcoRII	CCWGG	2 cut(s)	67, 380
FaeI	CATG	1 cut(s)	339
FaiI	YATR	2 cut(s)	83, 337
FatI	CATG	1 cut(s)	335
FokI	GGATG	1 cut(s)	103
FspBI	CTAG	2 cut(s)	75, 249
FspI	TGCGCA	1 cut(s)	340
GlaI	GCGC	1 cut(s)	340
HhaI	GCGC	1 cut(s)	341
Hin1II	CATG	1 cut(s)	339
Hin6I	GCGC	1 cut(s)	339
HinP1I	GCGC	1 cut(s)	339
Hpy188I	TCNGA	3 cut(s)	193, 274, 448
Hpy188III	TCNNGA	1 cut(s)	509
HpyAV	CCTTC	2 cut(s)	252, 349
HpyCH4III	ACNGT	2 cut(s)	8, 48
HpyCH4V	TGCA	3 cut(s)	4, 158, 201
HpyF10VI	GCNNNNNNNGC	2 cut(s)	425, 430
HpyF3I	CTNAG	2 cut(s)	192, 493
Hsp92II	CATG	1 cut(s)	339
HspAI	GCGC	1 cut(s)	339
Kzo9I	GATC	1 cut(s)	111
LpnPI	CCDG	8 cut(s)	54, 81, 141, 156, 367, 394, 447, 494
MaeI	CTAG	2 cut(s)	75, 249
MalI	GATC	1 cut(s)	113
MboI	GATC	1 cut(s)	111
MboII	GAAGA	1 cut(s)	209
MluCI	AATT	3 cut(s)	187, 229, 475
MnlI	CCTC	6 cut(s)	65, 310, 355, 403, 490, 524
MroXI	GAANNNNTTC	1 cut(s)	390
MseI	TTAA	4 cut(s)	51, 101, 330, 468
MspR9I	CCNGG	2 cut(s)	69, 382
MvaI	CCWGG	2 cut(s)	69, 382
MwoI	GCNNNNNNNGC	2 cut(s)	425, 430
NdeII	GATC	1 cut(s)	111
NheI	GCTAGC	1 cut(s)	248
NlaIII	CATG	1 cut(s)	339
NsbI	TGCGCA	1 cut(s)	340
NspI	RCATGY	1 cut(s)	339
PdmI	GAANNNNTTC	1 cut(s)	390
PfoI	TCCNGGA	1 cut(s)	67
PpuMI	RGGWCCY	1 cut(s)	511
PshBI	ATTAAT	1 cut(s)	468
Psp5II	RGGWCCY	1 cut(s)	511
Psp6I	CCWGG	2 cut(s)	67, 380
PspGI	CCWGG	2 cut(s)	67, 380
PspPI	GGNCC	2 cut(s)	71, 511
PspPPI	RGGWCCY	1 cut(s)	511
RsaI	GTAC	2 cut(s)	87, 279
RsaNI	GTAC	2 cut(s)	86, 278
SaqAI	TTAA	4 cut(s)	51, 101, 330, 468
Sau3AI	GATC	1 cut(s)	111
Sau96I	GGNCC	2 cut(s)	71, 511
ScaI	AGTACT	1 cut(s)	279
ScrFI	CCNGG	2 cut(s)	69, 382
SfcI	CTRYAG	1 cut(s)	44
SinI	GGWCC	2 cut(s)	71, 511
Sse9I	AATT	3 cut(s)	187, 229, 475
SspMI	CTAG	2 cut(s)	75, 249
StyD4I	CCNGG	2 cut(s)	67, 380
TaaI	ACNGT	2 cut(s)	8, 48
TaqI	TCGA	1 cut(s)	114
TasI	AATT	3 cut(s)	187, 229, 475
TatI	WGTACW	1 cut(s)	277
Tru1I	TTAA	4 cut(s)	51, 101, 330, 468
Tru9I	TTAA	4 cut(s)	51, 101, 330, 468
TspGWI	ACGGA	1 cut(s)	103
VpaK11BI	GGWCC	2 cut(s)	71, 511
VspI	ATTAAT	1 cut(s)	468
XapI	RAATTY	1 cut(s)	475
XceI	RCATGY	1 cut(s)	339
XmnI	GAANNNNTTC	1 cut(s)	390
XspI	CTAG	2 cut(s)	75, 249
ZrmI	AGTACT	1 cut(s)	279

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.