pycom07g27140

Ribosome-binding factor PSRP1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
26921285 .. 26921570
286 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g27140.2

Sequence Viewer

Length: 186 bp
ATGTTACTTGGGCAGATCGATCACGACTTCTATGCTTTCCGAAATGAAGAAACTGGTGAGATTAATGTAATATACAAACGAGAAGAAGGAGGTTATGGACTTATTATACCGAAAGGAAATGGTAAAGCGGAGAAGTCACAGCACGTGGTGGTAGAGCGAGCTAGAGAACGCTCCTTGGCGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.96

Weight (kDa)

5.66

Isoelectric Point (pI)

38.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015107)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G24490
fragaria_vesca FvH4_7g32900
malus_domestica MD07G1298900.v1.1
prunus_persica Prupe.2G318800_v2.0.a1
pyrus_communis pycom07g27140
rosa_chinensis RchiOBHm_Chr1g0382861
rosa_laevigata RLG00000026153
rosa_multiflora Rmu_sc0002242.1_g000012 Rmu_sc0010366.1_g000008
rosa_roxburghii Rroxscaffold_4G00277830
rosa_rugosa Rorug01G0436900
rosa_samantha Rh1AG461900 Rh1BG418900 Rh1CG432600 Rh1DG451000
rosa_wichuraiana Rw1G040990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 128, 179
AcvI CACGTG 1 cut(s) 145
AdeI CACNNNGTG 1 cut(s) 148
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
AseI ATTAAT 1 cut(s) 63
AsuHPI GGTGA 1 cut(s) 68
BbrPI CACGTG 1 cut(s) 145
BcgI CGANNNNNNTGC 2 cut(s) 14, 48
BfaI CTAG 1 cut(s) 162
Bsa29I ATCGAT 1 cut(s) 18
BsaAI YACGTR 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 174
Bse1I ACTGG 1 cut(s) 58
BseCI ATCGAT 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 174
BseNI ACTGG 1 cut(s) 58
BshVI ATCGAT 1 cut(s) 18
Bsp143I GATC 2 cut(s) 15, 19
BspACI CCGC 2 cut(s) 128, 179
BspDI ATCGAT 1 cut(s) 18
BsrI ACTGG 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 174
BssMI GATC 2 cut(s) 15, 19
BssT1I CCWWGG 1 cut(s) 174
BstBAI YACGTR 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 159
BstKTI GATC 2 cut(s) 18, 22
BstMBI GATC 2 cut(s) 15, 19
Bsu15I ATCGAT 1 cut(s) 18
BsuTUI ATCGAT 1 cut(s) 18
Cac8I GCNNGC 1 cut(s) 159
ClaI ATCGAT 1 cut(s) 18
CviJI RGCY 1 cut(s) 161
CviKI_1 RGCY 1 cut(s) 161
DpnI GATC 2 cut(s) 17, 21
DpnII GATC 2 cut(s) 15, 19
DraIII CACNNNGTG 1 cut(s) 148
Eco130I CCWWGG 1 cut(s) 174
Eco72I CACGTG 1 cut(s) 145
EcoT14I CCWWGG 1 cut(s) 174
ErhI CCWWGG 1 cut(s) 174
FaiI YATR 4 cut(s) 33, 73, 96, 107
FspBI CTAG 1 cut(s) 162
HphI GGTGA 1 cut(s) 68
Hpy188I TCNGA 1 cut(s) 41
Hpy188III TCNNGA 1 cut(s) 23
HpyAV CCTTC 1 cut(s) 80
HpyCH4IV ACGT 1 cut(s) 144
HpySE526I ACGT 1 cut(s) 144
Kzo9I GATC 2 cut(s) 15, 19
LmnI GCTCC 1 cut(s) 176
LpnPI CCDG 1 cut(s) 39
MaeI CTAG 1 cut(s) 162
MaeII ACGT 1 cut(s) 144
MaeIII GTNAC 2 cut(s) 3, 135
MalI GATC 2 cut(s) 17, 21
MboI GATC 2 cut(s) 15, 19
MboII GAAGA 2 cut(s) 59, 95
MnlI CCTC 1 cut(s) 83
MseI TTAA 1 cut(s) 63
NdeII GATC 2 cut(s) 15, 19
NmuCI GTSAC 1 cut(s) 135
PmaCI CACGTG 1 cut(s) 145
PmlI CACGTG 1 cut(s) 145
Ppu21I YACGTR 1 cut(s) 145
PshBI ATTAAT 1 cut(s) 63
PspCI CACGTG 1 cut(s) 145
SaqAI TTAA 1 cut(s) 63
Sau3AI GATC 2 cut(s) 15, 19
SetI ASST 3 cut(s) 94, 147, 163
SgeI CNNG 8 cut(s) 20, 35, 66, 92, 155, 157, 170, 174
SsiI CCGC 2 cut(s) 128, 179
SspMI CTAG 1 cut(s) 162
StyI CCWWGG 1 cut(s) 174
TaiI ACGT 1 cut(s) 147
TaqI TCGA 1 cut(s) 18
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TseFI GTSAC 1 cut(s) 135
Tsp45I GTSAC 1 cut(s) 135
TspDTI ATGAA 1 cut(s) 60
VspI ATTAAT 1 cut(s) 63
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.