Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002242.1

Orthogroup ID

OG0015107

Physical Location & Seq

Genomic Coordinates Reverse (-)

43080 .. 44902

Gene Structure 1823 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002242.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 834 bp

atggctactctaccatcaacctttttggcaaagccccaactctccaagctctcatctgactcctctaatttcttgaacacatgtaagaatttgagacccatttcgattgcgatcagacccagaaacaaggattatggtgtaaagatgtcatgggatggtccactttcttcggtcaagttgatcatacagggaaagcatttggagttgacagaaccaatcaagaagcatgtggaagacaaagttggaaaggcaatctcaaagcacagtcacctggtgagggaagctgatattcggttgtctgttcgaggtggagaccttggaaaaggcccaaagatcaggagatgtgaggtcactttgttcacaaagaagcatggagtgttcagggccgaggaagaaggggagacgcttattgctagcatagatctggcagcttctatcatccagaggaagttgaggaaaatcaaggagaaggtatcagatcatggccgtcacatgaaaggctttaacagattgaaagtcagggaggctcaaatacctgtggaagtggaagaagaagatccccaggaggaggaggaggaagacttattggatgaggttgtccgtacaaaatacttcgacatgccacctttgacagtcgctgaagcagtagatcaactggaaaaccttgatcatgacttctatgctttcagaaatgaagaaactggtgagattaacatcctatacagaagaaaaacaggaggctatggggttattatacccaaaggaagtgggaaagctgataaagtggagaatggggtggtagaacgagctagagaagcttccttggcagaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ribosom_S30AE_C Ribosomal_S30AE

Protein Analysis

277

Amino Acids

31.22

Weight (kDa)

7.76

Isoelectric Point (pI)

38.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015107)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G24490
fragaria_vesca	FvH4_7g32900
malus_domestica	MD07G1298900.v1.1
prunus_persica	Prupe.2G318800_v2.0.a1
pyrus_communis	pycom07g27140
rosa_chinensis	RchiOBHm_Chr1g0382861
rosa_laevigata	RLG00000026153
rosa_multiflora	Rmu_sc0002242.1_g000012 Rmu_sc0010366.1_g000008
rosa_roxburghii	Rroxscaffold_4G00277830
rosa_rugosa	Rorug01G0436900
rosa_samantha	Rh1AG461900 Rh1BG418900 Rh1CG432600 Rh1DG451000
rosa_wichuraiana	Rw1G040990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	551
AcoI	YGGCCR	1 cut(s)	484
AcsI	RAATTY	1 cut(s)	88
AcuI	CTGAAG	1 cut(s)	660
AdeI	CACNNNGTG	1 cut(s)	274
AfaI	GTAC	1 cut(s)	604
AfiI	CCNNNNNNNGG	2 cut(s)	277, 568
AflIII	ACRYGT	1 cut(s)	80
AgsI	TTSAA	2 cut(s)	76, 514
AjnI	CCWGG	2 cut(s)	270, 561
AjuI	GAANNNNNNNTTGG	2 cut(s)	225, 257
AluBI	AGCT	6 cut(s)	49, 284, 431, 776, 809, 818
AluI	AGCT	6 cut(s)	49, 284, 431, 776, 809, 818
Alw26I	GTCTC	3 cut(s)	88, 306, 395
AlwI	GGATC	1 cut(s)	551
AlwNI	CAGNNNCTG	1 cut(s)	638
AoxI	GGCC	3 cut(s)	325, 384, 484
ApeKI	GCWGC	1 cut(s)	428
ApoI	RAATTY	1 cut(s)	88
AspS9I	GGNCC	3 cut(s)	158, 326, 384
AsuHPI	GGTGA	3 cut(s)	260, 286, 716
AsuNHI	GCTAGC	1 cut(s)	413
AvaII	GGWCC	1 cut(s)	158
BbsI	GAAGAC	2 cut(s)	240, 585
BbvI	GCAGC	1 cut(s)	440
BccI	CCATC	2 cut(s)	22, 149
BceAI	ACGGC	1 cut(s)	471
BciT130I	CCWGG	2 cut(s)	272, 563
BclI	TGATCA	2 cut(s)	180, 667
BcoDI	GTCTC	3 cut(s)	88, 306, 395
BfaI	CTAG	2 cut(s)	414, 810
BglII	AGATCT	1 cut(s)	421
BisI	GCNGC	1 cut(s)	429
BlsI	GCNGC	1 cut(s)	430
Bme1390I	CCNGG	2 cut(s)	272, 563
Bme18I	GGWCC	1 cut(s)	158
BmgT120I	GGNCC	3 cut(s)	158, 326, 384
BmrFI	CCNGG	2 cut(s)	272, 563
BmtI	GCTAGC	1 cut(s)	417
BpiI	GAAGAC	2 cut(s)	240, 585
BsaBI	GATNNNNATC	2 cut(s)	110, 713
BsaI	GGTCTC	2 cut(s)	88, 306
BsaJI	CCNNGG	4 cut(s)	316, 387, 561, 822
Bsc4I	CCNNNNNNNGG	2 cut(s)	277, 568
Bse1I	ACTGG	2 cut(s)	660, 706
Bse8I	GATNNNNATC	2 cut(s)	110, 713
BseBI	CCWGG	2 cut(s)	272, 563
BseDI	CCNNGG	4 cut(s)	316, 387, 561, 822
BseGI	GGATG	4 cut(s)	160, 438, 595, 714
BseJI	GATNNNNATC	2 cut(s)	110, 713
BseLI	CCNNNNNNNGG	2 cut(s)	277, 568
BseNI	ACTGG	2 cut(s)	660, 706
BseRI	GAGGAG	4 cut(s)	52, 581, 584, 587
BseXI	GCAGC	1 cut(s)	440
BshFI	GGCC	3 cut(s)	327, 386, 486
BslI	CCNNNNNNNGG	2 cut(s)	277, 568
BsmAI	GTCTC	3 cut(s)	88, 306, 395
BsmBI	CGTCTC	1 cut(s)	395
BsnI	GGCC	3 cut(s)	327, 386, 486
Bso31I	GGTCTC	2 cut(s)	88, 306
Bsp143I	GATC	8 cut(s)	111, 180, 333, 421, 478, 556, 649, 667
BspANI	GGCC	3 cut(s)	327, 386, 486
BspHI	TCATGA	1 cut(s)	670
BspOI	GCTAGC	1 cut(s)	417
BspPI	GGATC	1 cut(s)	551
BspTNI	GGTCTC	2 cut(s)	88, 306
BsrI	ACTGG	2 cut(s)	660, 706
BssECI	CCNNGG	4 cut(s)	316, 387, 561, 822
BssMI	GATC	8 cut(s)	111, 180, 333, 421, 478, 556, 649, 667
BssT1I	CCWWGG	2 cut(s)	316, 822
Bst2UI	CCWGG	2 cut(s)	272, 563
Bst4CI	ACNGT	2 cut(s)	266, 634
BstC8I	GCNNGC	1 cut(s)	415
BstF5I	GGATG	4 cut(s)	160, 438, 595, 714
BstKTI	GATC	8 cut(s)	114, 183, 336, 424, 481, 559, 652, 670
BstMAI	GTCTC	3 cut(s)	88, 306, 395
BstMBI	GATC	8 cut(s)	111, 180, 333, 421, 478, 556, 649, 667
BstMWI	GCNNNNNNNGC	2 cut(s)	815, 824
BstNI	CCWGG	2 cut(s)	272, 563
BstNSI	RCATGY	3 cut(s)	84, 230, 622
BstSCI	CCNGG	2 cut(s)	270, 561
BstV1I	GCAGC	1 cut(s)	440
BstV2I	GAAGAC	2 cut(s)	240, 585
BstX2I	RGATCY	2 cut(s)	421, 556
BstYI	RGATCY	2 cut(s)	421, 556
BsuRI	GGCC	3 cut(s)	327, 386, 486
BtsCI	GGATG	4 cut(s)	160, 438, 595, 714
Cac8I	GCNNGC	1 cut(s)	415
CaiI	CAGNNNCTG	1 cut(s)	638
CciI	TCATGA	1 cut(s)	670
Cfr13I	GGNCC	3 cut(s)	158, 326, 384
CseI	GACGC	1 cut(s)	412
CsiI	ACCWGGT	1 cut(s)	270
Csp6I	GTAC	1 cut(s)	603
CspCI	CAANNNNNGTGG	2 cut(s)	748, 783
CviAII	CATG	8 cut(s)	81, 150, 227, 371, 482, 493, 619, 671
CviQI	GTAC	1 cut(s)	603
DpnI	GATC	8 cut(s)	113, 182, 335, 423, 480, 558, 651, 669
DpnII	GATC	8 cut(s)	111, 180, 333, 421, 478, 556, 649, 667
DraIII	CACNNNGTG	1 cut(s)	274
EaeI	YGGCCR	1 cut(s)	484
Eco130I	CCWWGG	2 cut(s)	316, 822
Eco31I	GGTCTC	2 cut(s)	88, 306
Eco47I	GGWCC	1 cut(s)	158
Eco57I	CTGAAG	1 cut(s)	660
EcoRII	CCWGG	2 cut(s)	270, 561
EcoT14I	CCWWGG	2 cut(s)	316, 822
ErhI	CCWWGG	2 cut(s)	316, 822
Esp3I	CGTCTC	1 cut(s)	395
FaeI	CATG	8 cut(s)	84, 153, 230, 374, 485, 496, 622, 674
FatI	CATG	8 cut(s)	80, 149, 226, 370, 481, 492, 618, 670
FbaI	TGATCA	2 cut(s)	180, 667
Fnu4HI	GCNGC	1 cut(s)	429
FokI	GGATG	4 cut(s)	167, 425, 602, 701
Fsp4HI	GCNGC	1 cut(s)	429
FspBI	CTAG	2 cut(s)	414, 810
GluI	GCNGC	1 cut(s)	429
HaeIII	GGCC	3 cut(s)	327, 386, 486
HgaI	GACGC	1 cut(s)	412
Hin1II	CATG	8 cut(s)	84, 153, 230, 374, 485, 496, 622, 674
HincII	GTYRAC	1 cut(s)	207
HindII	GTYRAC	1 cut(s)	207
HindIII	AAGCTT	1 cut(s)	816
HinfI	GANTC	1 cut(s)	59
HphI	GGTGA	3 cut(s)	260, 286, 716
Hpy166II	GTNNAC	3 cut(s)	161, 207, 360
Hpy188I	TCNGA	4 cut(s)	58, 116, 478, 689
Hpy188III	TCNNGA	5 cut(s)	73, 220, 337, 442, 671
Hpy8I	GTNNAC	3 cut(s)	161, 207, 360
HpyAV	CCTTC	2 cut(s)	389, 463
HpyCH4III	ACNGT	2 cut(s)	266, 634
HpyF10VI	GCNNNNNNNGC	2 cut(s)	815, 824
Hsp92II	CATG	8 cut(s)	84, 153, 230, 374, 485, 496, 622, 674
Ksp22I	TGATCA	2 cut(s)	180, 667
Kzo9I	GATC	8 cut(s)	111, 180, 333, 421, 478, 556, 649, 667
Lsp1109I	GCAGC	1 cut(s)	440
MabI	ACCWGGT	1 cut(s)	270
MaeI	CTAG	2 cut(s)	414, 810
MaeIII	GTNAC	3 cut(s)	266, 349, 488
MalI	GATC	8 cut(s)	113, 182, 335, 423, 480, 558, 651, 669
MboI	GATC	8 cut(s)	111, 180, 333, 421, 478, 556, 649, 667
MboII	GAAGA	9 cut(s)	159, 245, 404, 560, 563, 566, 590, 707, 738
MflI	RGATCY	2 cut(s)	421, 556
MluCI	AATT	2 cut(s)	67, 88
MlyI	GAGTC	1 cut(s)	53
MmeI	TCCRAC	1 cut(s)	223
MseI	TTAA	2 cut(s)	504, 711
MspR9I	CCNGG	2 cut(s)	272, 563
MvaI	CCWGG	2 cut(s)	272, 563
MwoI	GCNNNNNNNGC	2 cut(s)	815, 824
NdeII	GATC	8 cut(s)	111, 180, 333, 421, 478, 556, 649, 667
NheI	GCTAGC	1 cut(s)	413
NlaIII	CATG	8 cut(s)	84, 153, 230, 374, 485, 496, 622, 674
NmeAIII	GCCGAG	1 cut(s)	412
NmuCI	GTSAC	3 cut(s)	266, 349, 488
NspI	RCATGY	3 cut(s)	84, 230, 622
PagI	TCATGA	1 cut(s)	670
PciI	ACATGT	1 cut(s)	80
PkrI	GCNGC	1 cut(s)	430
PleI	GAGTC	1 cut(s)	53
PpsI	GAGTC	1 cut(s)	53
PscI	ACATGT	1 cut(s)	80
Psp6I	CCWGG	2 cut(s)	270, 561
PspGI	CCWGG	2 cut(s)	270, 561
PspPI	GGNCC	3 cut(s)	158, 326, 384
PstNI	CAGNNNCTG	1 cut(s)	638
PsuI	RGATCY	2 cut(s)	421, 556
RsaI	GTAC	1 cut(s)	604
RsaNI	GTAC	1 cut(s)	603
SaqAI	TTAA	2 cut(s)	504, 711
SatI	GCNGC	1 cut(s)	429
Sau3AI	GATC	8 cut(s)	111, 180, 333, 421, 478, 556, 649, 667
Sau96I	GGNCC	3 cut(s)	158, 326, 384
SchI	GAGTC	1 cut(s)	53
ScrFI	CCNGG	2 cut(s)	272, 563
SexAI	ACCWGGT	1 cut(s)	270
SinI	GGWCC	1 cut(s)	158
Sse9I	AATT	2 cut(s)	67, 88
SspMI	CTAG	2 cut(s)	414, 810
StyD4I	CCNGG	2 cut(s)	270, 561
StyI	CCWWGG	2 cut(s)	316, 822
TaaI	ACNGT	2 cut(s)	266, 634
TaqI	TCGA	3 cut(s)	104, 304, 615
TaqII	GACCGA	1 cut(s)	160
TasI	AATT	2 cut(s)	67, 88
Tru1I	TTAA	2 cut(s)	504, 711
Tru9I	TTAA	2 cut(s)	504, 711
TseFI	GTSAC	3 cut(s)	266, 349, 488
TseI	GCWGC	1 cut(s)	428
Tsp45I	GTSAC	3 cut(s)	266, 349, 488
TspDTI	ATGAA	2 cut(s)	509, 708
TspGWI	ACGGA	1 cut(s)	590
VpaK11BI	GGWCC	1 cut(s)	158
XapI	RAATTY	1 cut(s)	88
XceI	RCATGY	3 cut(s)	84, 230, 622
XspI	CTAG	2 cut(s)	414, 810

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.