pycom08g17790

Rhamnogalacturonate lyase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0008923
Physical Location & Seq
Reverse (-)
17924904 .. 17925107
204 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGATAGGGAAAGACAACTCAATAGCAAGGCATGGAATCCACGGGCTTTACTGGCTTTACAATGTAGACGTACCAAGCTCTCGGCTTGTCGAGGGAGACAATATTATATATTTGACGCAACCAAGAAGCACAACAGGCCCTTTCCAGGGTATTATGTATGATTATCTTCGCTTAGAAGGTCCCCCATCTCCAAGCTCCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CBM-like Rhamnogal_lyase fn3_3

Protein Analysis

68

Amino Acids

7.52

Weight (kDa)

6.7

Isoelectric Point (pI)

60.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CBM-like PF14683 2 - 58 7.3e-18 Polysaccharide lyase family 4, domain III
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 66
AfaI GTAC 1 cut(s) 72
AfiI CCNNNNNNNGG 2 cut(s) 145, 146
AjnI CCWGG 1 cut(s) 144
AluBI AGCT 2 cut(s) 78, 195
AluI AGCT 2 cut(s) 78, 195
Alw26I GTCTC 1 cut(s) 90
AoxI GGCC 1 cut(s) 136
AspS9I GGNCC 2 cut(s) 137, 179
AvaII GGWCC 1 cut(s) 179
BccI CCATC 1 cut(s) 193
BciT130I CCWGG 1 cut(s) 146
BcoDI GTCTC 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 146
Bme18I GGWCC 1 cut(s) 179
BmgT120I GGNCC 2 cut(s) 137, 179
BmiI GGNNCC 1 cut(s) 181
BmrFI CCNGG 1 cut(s) 146
BsaJI CCNNGG 2 cut(s) 40, 145
Bsc4I CCNNNNNNNGG 2 cut(s) 145, 146
Bse1I ACTGG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 146
BseDI CCNNGG 2 cut(s) 40, 145
BseLI CCNNNNNNNGG 2 cut(s) 145, 146
BseNI ACTGG 1 cut(s) 56
BshFI GGCC 1 cut(s) 138
BslFI GGGAC 1 cut(s) 165
BslI CCNNNNNNNGG 2 cut(s) 145, 146
BsmAI GTCTC 1 cut(s) 90
BsmFI GGGAC 1 cut(s) 165
BsnI GGCC 1 cut(s) 138
BspANI GGCC 1 cut(s) 138
BspLI GGNNCC 1 cut(s) 181
BsrI ACTGG 1 cut(s) 56
BssECI CCNNGG 2 cut(s) 40, 145
Bst2UI CCWGG 1 cut(s) 146
BstDEI CTNAG 1 cut(s) 172
BstDSI CCRYGG 1 cut(s) 40
BstMAI GTCTC 1 cut(s) 90
BstMWI GCNNNNNNNGC 2 cut(s) 52, 135
BstNI CCWGG 1 cut(s) 146
BstSCI CCNGG 1 cut(s) 144
BsuRI GGCC 1 cut(s) 138
BtgI CCRYGG 1 cut(s) 40
Cfr13I GGNCC 2 cut(s) 137, 179
CseI GACGC 1 cut(s) 124
Csp6I GTAC 1 cut(s) 71
CviAII CATG 1 cut(s) 32
CviJI RGCY 6 cut(s) 46, 55, 78, 85, 138, 195
CviKI_1 RGCY 6 cut(s) 46, 55, 78, 85, 138, 195
CviQI GTAC 1 cut(s) 71
DdeI CTNAG 1 cut(s) 172
Eco47I GGWCC 1 cut(s) 179
EcoO109I RGGNCCY 2 cut(s) 137, 179
EcoRII CCWGG 1 cut(s) 144
FaeI CATG 1 cut(s) 35
FaiI YATR 5 cut(s) 33, 107, 109, 155, 159
FaqI GGGAC 1 cut(s) 165
FatI CATG 1 cut(s) 31
FblI GTMKAC 1 cut(s) 66
HaeIII GGCC 1 cut(s) 138
HgaI GACGC 1 cut(s) 124
Hin1II CATG 1 cut(s) 35
HinfI GANTC 1 cut(s) 36
Hpy166II GTNNAC 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 67
HpyAV CCTTC 1 cut(s) 170
HpyCH4IV ACGT 1 cut(s) 69
HpyF10VI GCNNNNNNNGC 2 cut(s) 52, 135
HpyF3I CTNAG 1 cut(s) 172
HpySE526I ACGT 1 cut(s) 69
Hsp92II CATG 1 cut(s) 35
LmnI GCTCC 1 cut(s) 200
LpnPI CCDG 4 cut(s) 37, 120, 131, 158
MaeII ACGT 1 cut(s) 69
MboII GAAGA 1 cut(s) 158
MnlI CCTC 1 cut(s) 85
MspR9I CCNGG 1 cut(s) 146
MvaI CCWGG 1 cut(s) 146
MwoI GCNNNNNNNGC 2 cut(s) 52, 135
NlaIII CATG 1 cut(s) 35
NlaIV GGNNCC 1 cut(s) 181
NmeAIII GCCGAG 1 cut(s) 61
PfeI GAWTC 1 cut(s) 36
PpuMI RGGWCCY 1 cut(s) 179
Psp5II RGGWCCY 1 cut(s) 179
Psp6I CCWGG 1 cut(s) 144
PspGI CCWGG 1 cut(s) 144
PspN4I GGNNCC 1 cut(s) 181
PspPI GGNCC 2 cut(s) 137, 179
PspPPI RGGWCCY 1 cut(s) 179
RsaI GTAC 1 cut(s) 72
RsaNI GTAC 1 cut(s) 71
Sau96I GGNCC 2 cut(s) 137, 179
ScrFI CCNGG 1 cut(s) 146
SetI ASST 4 cut(s) 72, 80, 181, 197
SinI GGWCC 1 cut(s) 179
SspI AATATT 1 cut(s) 103
StyD4I CCNGG 1 cut(s) 144
TaiI ACGT 1 cut(s) 72
TaqI TCGA 1 cut(s) 90
TfiI GAWTC 1 cut(s) 36
VpaK11BI GGWCC 1 cut(s) 179
XmiI GTMKAC 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.