pycom09g01470

Epidermal patterning factor proteins

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
1170690 .. 1171157
468 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g01470.2

Sequence Viewer

Length: 312 bp
ATGAAGGGTTCAATTTGTGTAGCTACATTTCTTGTTGTCATTCTTTTCCTTCCACAATCCATATCCGCAAGGTGCATAGCTCGGCCTCATTCACATCATCATGGGCGCCGTCTGAAGAGTACACTTAGAGAAGCATTAGTGGATAAAAAGGCAAGTAATTATAAGAGAGTTAGGGGGCCAGATACAGTCCAAGTGGCAGGACCATGCAGACTAGTGATGGTGAGCTTTGTTTGTGCATCAATCACTGAGGCTGAAACATGTCCAATGGCTTACAAGTGCATGTGCAAAAACAAGTTTTATCATGTTCCTTAG

Protein Analysis

104

Amino Acids

11.51

Weight (kDa)

9.76

Isoelectric Point (pI)

39.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016712)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G20875
fragaria_vesca FvH4_6g45090
malus_domestica MD09G1089600.v1.1 MD17G1079000.v1.1
prunus_persica Prupe.3G235800_v2.0.a1
pyrus_communis pycom09g01470 pycom17g07820
rosa_chinensis RchiOBHm_Chr2g0162501
rosa_multiflora Rmu_co8426761.1_g000001 Rmu_sc0004206.1_g000014
rosa_roxburghii Rroxscaffold_2G00087890
rosa_samantha Rh2AG564000 Rh2CG546600
rosa_wichuraiana Rw2G046660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 162
AccB1I GGYRCC 1 cut(s) 105
AciI CCGC 1 cut(s) 66
AcuI CTGAAG 1 cut(s) 134
AcyI GRCGYC 1 cut(s) 106
AfaI GTAC 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 257
AgsI TTSAA 1 cut(s) 12
AhlI ACTAGT 1 cut(s) 211
AluBI AGCT 3 cut(s) 23, 80, 225
AluI AGCT 3 cut(s) 23, 80, 225
AoxI GGCC 2 cut(s) 83, 176
AspLEI GCGC 1 cut(s) 108
AspS9I GGNCC 2 cut(s) 176, 200
AsuHPI GGTGA 1 cut(s) 232
AvaII GGWCC 1 cut(s) 200
BanI GGYRCC 1 cut(s) 105
BccI CCATC 1 cut(s) 211
BceAI ACGGC 1 cut(s) 93
BcuI ACTAGT 1 cut(s) 211
BfaI CTAG 1 cut(s) 212
BfoI RGCGCY 1 cut(s) 109
Bme18I GGWCC 1 cut(s) 200
BmgT120I GGNCC 2 cut(s) 176, 200
BmiI GGNNCC 2 cut(s) 107, 177
BmsI GCATC 1 cut(s) 245
BsaHI GRCGYC 1 cut(s) 106
BseMII CTCAG 1 cut(s) 237
BshFI GGCC 2 cut(s) 85, 178
BshNI GGYRCC 1 cut(s) 105
BsnI GGCC 2 cut(s) 85, 178
BspACI CCGC 1 cut(s) 66
BspANI GGCC 2 cut(s) 85, 178
BspCNI CTCAG 1 cut(s) 238
BspLI GGNNCC 2 cut(s) 107, 177
BspT107I GGYRCC 1 cut(s) 105
BssNI GRCGYC 1 cut(s) 106
Bst4CI ACNGT 1 cut(s) 187
Bst6I CTCTTC 1 cut(s) 110
BstACI GRCGYC 1 cut(s) 106
BstDEI CTNAG 3 cut(s) 125, 246, 309
BstH2I RGCGCY 1 cut(s) 109
BstHHI GCGC 1 cut(s) 108
BstNSI RCATGY 2 cut(s) 261, 283
BsuRI GGCC 2 cut(s) 85, 178
BtsIMutI CAGTG 1 cut(s) 243
CfoI GCGC 1 cut(s) 108
Cfr13I GGNCC 2 cut(s) 176, 200
Csp6I GTAC 1 cut(s) 120
CviAII CATG 5 cut(s) 101, 204, 258, 280, 302
CviJI RGCY 7 cut(s) 23, 80, 85, 178, 225, 251, 269
CviKI_1 RGCY 7 cut(s) 23, 80, 85, 178, 225, 251, 269
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 3 cut(s) 125, 246, 309
DinI GGCGCC 1 cut(s) 107
Eam1104I CTCTTC 1 cut(s) 110
EarI CTCTTC 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 200
Eco57I CTGAAG 1 cut(s) 134
EgeI GGCGCC 1 cut(s) 107
EheI GGCGCC 1 cut(s) 107
FaeI CATG 5 cut(s) 104, 207, 261, 283, 305
FaiI YATR 8 cut(s) 62, 77, 102, 162, 205, 259, 281, 303
FatI CATG 5 cut(s) 100, 203, 257, 279, 301
FspBI CTAG 1 cut(s) 212
GlaI GCGC 1 cut(s) 107
HaeII RGCGCY 1 cut(s) 109
HaeIII GGCC 2 cut(s) 85, 178
HhaI GCGC 1 cut(s) 108
Hin1I GRCGYC 1 cut(s) 106
Hin1II CATG 5 cut(s) 104, 207, 261, 283, 305
Hin6I GCGC 1 cut(s) 106
HinP1I GCGC 1 cut(s) 106
HphI GGTGA 1 cut(s) 232
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 114
Hpy8I GTNNAC 1 cut(s) 122
HpyAV CCTTC 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 187
HpyCH4V TGCA 5 cut(s) 75, 207, 236, 279, 285
HpyF3I CTNAG 3 cut(s) 125, 246, 309
Hsp92I GRCGYC 1 cut(s) 106
Hsp92II CATG 5 cut(s) 104, 207, 261, 283, 305
HspAI GCGC 1 cut(s) 106
KasI GGCGCC 1 cut(s) 105
LpnPI CCDG 2 cut(s) 183, 192
LweI GCATC 1 cut(s) 245
MaeI CTAG 1 cut(s) 212
MboII GAAGA 1 cut(s) 127
MluCI AATT 2 cut(s) 12, 157
Mly113I GGCGCC 1 cut(s) 106
MnlI CCTC 2 cut(s) 96, 241
MslI CAYNNNNRTG 1 cut(s) 99
NarI GGCGCC 1 cut(s) 106
NlaIII CATG 5 cut(s) 104, 207, 261, 283, 305
NlaIV GGNNCC 2 cut(s) 107, 177
NmeAIII GCCGAG 1 cut(s) 61
NspI RCATGY 2 cut(s) 261, 283
PciI ACATGT 1 cut(s) 257
PluTI GGCGCC 1 cut(s) 109
PscI ACATGT 1 cut(s) 257
PsiI TTATAA 1 cut(s) 162
PspN4I GGNNCC 2 cut(s) 107, 177
PspPI GGNCC 2 cut(s) 176, 200
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
RseI CAYNNNNRTG 1 cut(s) 99
Sau96I GGNCC 2 cut(s) 176, 200
SetI ASST 4 cut(s) 25, 74, 82, 227
SfaNI GCATC 1 cut(s) 245
SfoI GGCGCC 1 cut(s) 107
SinI GGWCC 1 cut(s) 200
SmiMI CAYNNNNRTG 1 cut(s) 99
SpeI ACTAGT 1 cut(s) 211
Sse9I AATT 2 cut(s) 12, 157
SsiI CCGC 1 cut(s) 66
SspDI GGCGCC 1 cut(s) 105
SspMI CTAG 1 cut(s) 212
TaaI ACNGT 1 cut(s) 187
TasI AATT 2 cut(s) 12, 157
TatI WGTACW 1 cut(s) 119
TscAI CASTG 1 cut(s) 250
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 250
VpaK11BI GGWCC 1 cut(s) 200
XceI RCATGY 2 cut(s) 261, 283
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.