pycom11g10070

Lignin degradation and detoxification of lignin-derived products

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0018508
Physical Location & Seq
Forward (+)
8416481 .. 8417718
1238 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 309 bp
ATGAAACACTCAAAAGTTTGTTCTAACAACCGTATATGCATATCCCTGGGTGTTCATCTTCTTTCAACACCACCATTTCTTAGGCTCTTTCTCTTCTCCGTCATAACGTTTTGTGTTATTCCTCAACATGCTCTTGCTGGCATAACCAGACACTACAAGTTTCAAAACGTGACAAGATTGTGTCACACAAAGAGCATAATAACAGTGAACGGGCAGTTTCCTGGCCCTAGAATCATTGCTAGAGAGGGTGATCAACTCCTAATTAAAGTGGTTAACCACGTCCAAAACAACATCTCTATCCACTGGTAA

Protein Analysis

103

Amino Acids

11.6

Weight (kDa)

10.32

Isoelectric Point (pI)

26.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase_3 PF07732 55 - 102 2.3e-14 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018508)

Species Orthologous Gene IDs
malus_domestica MD12G1156900.v1.1
pyrus_communis pycom11g10070
rosa_chinensis RchiOBHm_Chr6g0263741
rosa_multiflora Rmu_sc0024604.1_g000001
rosa_samantha Rh3BG132800 Rh5BG418700 Rh5BG419000 Rh5BG523200 Rh5DG535500 Rh6AG129000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 107
AgsI TTSAA 2 cut(s) 66, 164
AjiI CACGTC 1 cut(s) 280
AjnI CCWGG 2 cut(s) 45, 220
AoxI GGCC 1 cut(s) 223
AspS9I GGNCC 1 cut(s) 224
AsuHPI GGTGA 1 cut(s) 260
BciT130I CCWGG 2 cut(s) 47, 222
BclI TGATCA 1 cut(s) 250
BfaI CTAG 2 cut(s) 228, 240
Bme1390I CCNGG 2 cut(s) 47, 222
BmgBI CACGTC 1 cut(s) 280
BmgT120I GGNCC 1 cut(s) 224
BmrFI CCNGG 2 cut(s) 47, 222
BsaJI CCNNGG 2 cut(s) 45, 46
Bse1I ACTGG 1 cut(s) 308
Bse3DI GCAATG 1 cut(s) 234
BseBI CCWGG 2 cut(s) 47, 222
BseDI CCNNGG 2 cut(s) 45, 46
BseMI GCAATG 1 cut(s) 234
BseNI ACTGG 1 cut(s) 308
BshFI GGCC 1 cut(s) 225
BsnI GGCC 1 cut(s) 225
Bsp143I GATC 1 cut(s) 250
BspANI GGCC 1 cut(s) 225
BsrDI GCAATG 1 cut(s) 234
BsrI ACTGG 1 cut(s) 308
BssECI CCNNGG 2 cut(s) 45, 46
BssMI GATC 1 cut(s) 250
Bst2UI CCWGG 2 cut(s) 47, 222
Bst4CI ACNGT 2 cut(s) 32, 205
Bst6I CTCTTC 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 80
BstKTI GATC 1 cut(s) 253
BstMBI GATC 1 cut(s) 250
BstNI CCWGG 2 cut(s) 47, 222
BstNSI RCATGY 1 cut(s) 131
BstSCI CCNGG 2 cut(s) 45, 220
BsuRI GGCC 1 cut(s) 225
BtrI CACGTC 1 cut(s) 280
BtsIMutI CAGTG 2 cut(s) 210, 301
Cac8I GCNNGC 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 224
CviAII CATG 1 cut(s) 128
CviJI RGCY 2 cut(s) 85, 225
CviKI_1 RGCY 2 cut(s) 85, 225
DdeI CTNAG 1 cut(s) 80
DpnI GATC 1 cut(s) 252
DpnII GATC 1 cut(s) 250
Eam1104I CTCTTC 1 cut(s) 98
EarI CTCTTC 1 cut(s) 98
EcoRII CCWGG 2 cut(s) 45, 220
EcoT22I ATGCAT 1 cut(s) 41
FaeI CATG 1 cut(s) 131
FaiI YATR 7 cut(s) 35, 37, 41, 104, 129, 143, 197
FatI CATG 1 cut(s) 127
FbaI TGATCA 1 cut(s) 250
FspBI CTAG 2 cut(s) 228, 240
HaeIII GGCC 1 cut(s) 225
Hin1II CATG 1 cut(s) 131
HincII GTYRAC 1 cut(s) 274
HindII GTYRAC 1 cut(s) 274
HinfI GANTC 1 cut(s) 231
HpaI GTTAAC 1 cut(s) 274
HphI GGTGA 1 cut(s) 260
Hpy166II GTNNAC 2 cut(s) 208, 274
Hpy8I GTNNAC 2 cut(s) 208, 274
HpyCH4III ACNGT 2 cut(s) 32, 205
HpyCH4IV ACGT 3 cut(s) 107, 168, 279
HpyCH4V TGCA 1 cut(s) 39
HpyF3I CTNAG 1 cut(s) 80
HpySE526I ACGT 3 cut(s) 107, 168, 279
Hsp92II CATG 1 cut(s) 131
Ksp22I TGATCA 1 cut(s) 250
KspAI GTTAAC 1 cut(s) 274
Kzo9I GATC 1 cut(s) 250
LpnPI CCDG 7 cut(s) 32, 59, 123, 160, 207, 234, 289
MaeI CTAG 2 cut(s) 228, 240
MaeII ACGT 3 cut(s) 107, 168, 279
MaeIII GTNAC 2 cut(s) 169, 182
MalI GATC 1 cut(s) 252
MboI GATC 1 cut(s) 250
MboII GAAGA 2 cut(s) 50, 85
MluCI AATT 1 cut(s) 261
MnlI CCTC 2 cut(s) 132, 238
Mph1103I ATGCAT 1 cut(s) 41
MseI TTAA 2 cut(s) 264, 273
MspR9I CCNGG 2 cut(s) 47, 222
MvaI CCWGG 2 cut(s) 47, 222
NdeII GATC 1 cut(s) 250
NlaIII CATG 1 cut(s) 131
NmuCI GTSAC 2 cut(s) 169, 182
NsiI ATGCAT 1 cut(s) 41
NspI RCATGY 1 cut(s) 131
PasI CCCWGGG 1 cut(s) 46
PfeI GAWTC 1 cut(s) 231
Psp1406I AACGTT 1 cut(s) 107
Psp6I CCWGG 2 cut(s) 45, 220
PspGI CCWGG 2 cut(s) 45, 220
PspPI GGNCC 1 cut(s) 224
SaqAI TTAA 2 cut(s) 264, 273
Sau3AI GATC 1 cut(s) 250
Sau96I GGNCC 1 cut(s) 224
ScrFI CCNGG 2 cut(s) 47, 222
SetI ASST 3 cut(s) 110, 171, 282
Sse9I AATT 1 cut(s) 261
SspMI CTAG 2 cut(s) 228, 240
StyD4I CCNGG 2 cut(s) 45, 220
TaaI ACNGT 2 cut(s) 32, 205
TaiI ACGT 3 cut(s) 110, 171, 282
TasI AATT 1 cut(s) 261
TfiI GAWTC 1 cut(s) 231
Tru1I TTAA 2 cut(s) 264, 273
Tru9I TTAA 2 cut(s) 264, 273
TscAI CASTG 2 cut(s) 210, 308
TseFI GTSAC 2 cut(s) 169, 182
Tsp45I GTSAC 2 cut(s) 169, 182
TspDTI ATGAA 2 cut(s) 17, 44
TspGWI ACGGA 1 cut(s) 88
TspRI CASTG 2 cut(s) 210, 308
XceI RCATGY 1 cut(s) 131
XspI CTAG 2 cut(s) 228, 240
Zsp2I ATGCAT 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.