RchiOBHm_Chr6g0263741

Belongs to the multicopper oxidase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0018508
Physical Location & Seq
Forward (+)
18618438 .. 18618614
177 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23654

Sequence Viewer

Length: 177 bp
ATGTTTTTCATTTATATGCAGATTCAAGTAAAGAATGTGAGCAGGTTGTGCCATCCTAAGCCAATTGTTACAGTTAATGGGATGTTCCCTGGACCTACAATCTACGCTAGAGAAGGCGATACAGTTCTAGTTAATGTTACCAACCATGCACAGTATAACATGTCAATTCATTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu-oxidase Cu-oxidase_2 Cu-oxidase_3 Pectinesterase

Protein Analysis

58

Amino Acids

6.71

Weight (kDa)

9.04

Isoelectric Point (pI)

24.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase_3 PF07732 8 - 58 5e-16 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018508)

Species Orthologous Gene IDs
malus_domestica MD12G1156900.v1.1
pyrus_communis pycom11g10070
rosa_chinensis RchiOBHm_Chr6g0263741
rosa_multiflora Rmu_sc0024604.1_g000001
rosa_samantha Rh3BG132800 Rh5BG418700 Rh5BG419000 Rh5BG523200 Rh5DG535500 Rh6AG129000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 33
AflIII ACRYGT 1 cut(s) 159
AgsI TTSAA 1 cut(s) 26
AjnI CCWGG 1 cut(s) 88
AspS9I GGNCC 1 cut(s) 92
AvaII GGWCC 1 cut(s) 92
BccI CCATC 1 cut(s) 60
BciT130I CCWGG 1 cut(s) 90
BfaI CTAG 2 cut(s) 108, 128
BfuAI ACCTGC 1 cut(s) 33
Bme1390I CCNGG 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 90
Bpu10I CCTNAGC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 88
BseBI CCWGG 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 88
BseGI GGATG 2 cut(s) 52, 87
BspMI ACCTGC 1 cut(s) 33
BssECI CCNNGG 1 cut(s) 88
Bst2UI CCWGG 1 cut(s) 90
Bst4CI ACNGT 3 cut(s) 73, 124, 153
BstAPI GCANNNNNTGC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 2 cut(s) 52, 87
BstMWI GCNNNNNNNGC 1 cut(s) 48
BstNI CCWGG 1 cut(s) 90
BstNSI RCATGY 1 cut(s) 163
BstSCI CCNGG 1 cut(s) 88
BtsCI GGATG 2 cut(s) 52, 87
BveI ACCTGC 1 cut(s) 33
Cfr13I GGNCC 1 cut(s) 92
CviAII CATG 2 cut(s) 146, 160
CviJI RGCY 1 cut(s) 61
CviKI_1 RGCY 1 cut(s) 61
DdeI CTNAG 1 cut(s) 57
Eco47I GGWCC 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 88
FaeI CATG 2 cut(s) 149, 163
FaiI YATR 5 cut(s) 15, 17, 147, 156, 161
FatI CATG 2 cut(s) 145, 159
FokI GGATG 2 cut(s) 39, 94
FspBI CTAG 2 cut(s) 108, 128
Hin1II CATG 2 cut(s) 149, 163
HinfI GANTC 1 cut(s) 22
HpyAV CCTTC 1 cut(s) 107
HpyCH4III ACNGT 3 cut(s) 73, 124, 153
HpyCH4V TGCA 2 cut(s) 19, 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
HpyF3I CTNAG 1 cut(s) 57
Hsp92II CATG 2 cut(s) 149, 163
LpnPI CCDG 3 cut(s) 28, 75, 102
MaeI CTAG 2 cut(s) 108, 128
MaeIII GTNAC 2 cut(s) 67, 136
MfeI CAATTG 1 cut(s) 63
MluCI AATT 2 cut(s) 63, 165
MseI TTAA 2 cut(s) 75, 132
MslI CAYNNNNRTG 1 cut(s) 14
MspR9I CCNGG 1 cut(s) 90
MunI CAATTG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 48
NlaIII CATG 2 cut(s) 149, 163
NspI RCATGY 1 cut(s) 163
PciI ACATGT 1 cut(s) 159
PfeI GAWTC 1 cut(s) 22
PscI ACATGT 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 88
PspGI CCWGG 1 cut(s) 88
PspPI GGNCC 1 cut(s) 92
RseI CAYNNNNRTG 1 cut(s) 14
SaqAI TTAA 2 cut(s) 75, 132
Sau96I GGNCC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 90
SetI ASST 2 cut(s) 47, 97
SgeI CNNG 8 cut(s) 38, 55, 101, 102, 120, 140, 158, 172
SinI GGWCC 1 cut(s) 92
SmiMI CAYNNNNRTG 1 cut(s) 14
Sse9I AATT 2 cut(s) 63, 165
SspMI CTAG 2 cut(s) 108, 128
StyD4I CCNGG 1 cut(s) 88
TaaI ACNGT 3 cut(s) 73, 124, 153
TasI AATT 2 cut(s) 63, 165
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 2 cut(s) 75, 132
Tru9I TTAA 2 cut(s) 75, 132
TspDTI ATGAA 1 cut(s) 158
VpaK11BI GGWCC 1 cut(s) 92
XceI RCATGY 1 cut(s) 163
XspI CTAG 2 cut(s) 108, 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.