pycom12g07200

Protein of unknown function (DUF4005)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
7465823 .. 7466234
412 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g07200.1

Sequence Viewer

Length: 258 bp
ATGAGAGATGTAGCGACAGCGGAAAGGGAGTTGGAAGAAAATGAAACACCACTTGGATGTAGCAACCAGAGAGGGTGGGATTTCAGTATAATTTCACAGGAAGATGTAGAATCGGCACTGCTAAGAAAGCAACAGGCCATGACCAAAAGAGATACTAGTCTTCTTCCATCGCCAGTGCCTCTGCAACTCTGGTCTTCTGTTCCATGCCCTCTCGTCTTAGGCAGACTCGGATATGCAAATCAACTCTCTGGATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.49

Weight (kDa)

4.76

Isoelectric Point (pI)

56.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012790)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 20
AhlI ACTAGT 1 cut(s) 155
AjuI GAANNNNNNNTTGG 2 cut(s) 36, 68
AoxI GGCC 1 cut(s) 135
BbsI GAAGAC 2 cut(s) 152, 186
BccI CCATC 1 cut(s) 175
BciVI GTATCC 1 cut(s) 245
BcuI ACTAGT 1 cut(s) 155
BfaI CTAG 2 cut(s) 156, 256
BfuI GTATCC 1 cut(s) 245
BpiI GAAGAC 2 cut(s) 152, 186
Bse1I ACTGG 1 cut(s) 173
BseGI GGATG 1 cut(s) 62
BseNI ACTGG 1 cut(s) 173
BshFI GGCC 1 cut(s) 137
BsnI GGCC 1 cut(s) 137
BspACI CCGC 1 cut(s) 20
BspANI GGCC 1 cut(s) 137
BsrI ACTGG 1 cut(s) 173
BstDEI CTNAG 2 cut(s) 122, 217
BstF5I GGATG 1 cut(s) 62
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstV2I GAAGAC 2 cut(s) 152, 186
BsuI GTATCC 1 cut(s) 245
BsuRI GGCC 1 cut(s) 137
BtgZI GCGATG 1 cut(s) 153
BtsCI GGATG 1 cut(s) 62
BtsI GCAGTG 1 cut(s) 116
BtsIMutI CAGTG 2 cut(s) 116, 180
CviAII CATG 2 cut(s) 139, 204
CviJI RGCY 1 cut(s) 137
CviKI_1 RGCY 1 cut(s) 137
DdeI CTNAG 2 cut(s) 122, 217
FaeI CATG 2 cut(s) 142, 207
FaiI YATR 4 cut(s) 89, 140, 205, 234
FatI CATG 2 cut(s) 138, 203
FokI GGATG 1 cut(s) 69
FspBI CTAG 2 cut(s) 156, 256
HaeIII GGCC 1 cut(s) 137
Hin1II CATG 2 cut(s) 142, 207
HinfI GANTC 2 cut(s) 110, 225
Hpy188I TCNGA 1 cut(s) 230
Hpy188III TCNNGA 1 cut(s) 249
HpyCH4V TGCA 2 cut(s) 184, 236
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpyF3I CTNAG 2 cut(s) 122, 217
Hsp92II CATG 2 cut(s) 142, 207
LpnPI CCDG 6 cut(s) 80, 83, 119, 175, 186, 234
MaeI CTAG 2 cut(s) 156, 256
MboII GAAGA 5 cut(s) 47, 113, 152, 155, 186
MluCI AATT 1 cut(s) 90
MlyI GAGTC 1 cut(s) 219
MmeI TCCRAC 1 cut(s) 12
MnlI CCTC 3 cut(s) 65, 189, 219
MslI CAYNNNNRTG 1 cut(s) 55
MspA1I CMGCKG 1 cut(s) 20
MwoI GCNNNNNNNGC 1 cut(s) 127
NlaIII CATG 2 cut(s) 142, 207
PfeI GAWTC 1 cut(s) 110
PleI GAGTC 1 cut(s) 219
PpsI GAGTC 1 cut(s) 219
RseI CAYNNNNRTG 1 cut(s) 55
SchI GAGTC 1 cut(s) 219
SmiMI CAYNNNNRTG 1 cut(s) 55
SpeI ACTAGT 1 cut(s) 155
Sse9I AATT 1 cut(s) 90
SsiI CCGC 1 cut(s) 20
SspMI CTAG 2 cut(s) 156, 256
TasI AATT 1 cut(s) 90
TfiI GAWTC 1 cut(s) 110
TscAI CASTG 2 cut(s) 123, 180
TspDTI ATGAA 1 cut(s) 57
TspRI CASTG 2 cut(s) 123, 180
XspI CTAG 2 cut(s) 156, 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.