pycom13g14510

Flowering-promoting factor 1-like protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Reverse (-)
10501446 .. 10501769
324 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g14510.1

Sequence Viewer

Length: 324 bp
ATGTCTGGGGTTTGGGTTTTCAAGAATGGCGTCGTCCGGTTGGTGGACGGGGCGGATTCCTTGCAAGGCTCCAACTCTCGGCCACGCAAGGTGCTCGTCCACACTCCAACTGACGAGGTCATCAGCTCTTATGCCGTGCTCGAACGCAAGCTGTACTCACTCGGTTGGGAGAGATACTATGACGATCCAGAGCTTCTTCAGTTCCACAAACGATCCACCGTCCATCTCATCTCTCTCCCCAAGGATATCAACAAGTTCAAGTCCATGCACATGTATGACATTGTTGTTAAAAATCGCAATGTGTTTGAAGTGAGGGACACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.47

Weight (kDa)

9.26

Isoelectric Point (pI)

45.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013941)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G31380
fragaria_vesca FvH4_4g17910
malus_domestica MD13G1169600.v1.1 MD16G1169700.v1.1
prunus_persica Prupe.1G137800_v2.0.a1
pyrus_communis pycom13g14510 pycom16g14320
rosa_chinensis RchiOBHm_Chr4g0422041
rosa_laevigata RLG00000007638
rosa_multiflora Rmu_sc0012856.1_g000018
rosa_roxburghii Rroxscaffold_5G00364160
rosa_rugosa Rorug04G0176900.1
rosa_samantha Rh4AG236500 Rh4BG239300 Rh4CG251300 Rh4DG235500
rosa_wichuraiana Rw4G019820

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 53
AclWI GGATC 2 cut(s) 179, 207
AcoI YGGCCR 1 cut(s) 80
AcuI CTGAAG 1 cut(s) 182
AcyI GRCGYC 1 cut(s) 30
AfaI GTAC 1 cut(s) 155
AfiI CCNNNNNNNGG 2 cut(s) 43, 78
AflIII ACRYGT 2 cut(s) 270, 318
AgsI TTSAA 3 cut(s) 22, 259, 308
AluBI AGCT 3 cut(s) 126, 151, 193
AluI AGCT 3 cut(s) 126, 151, 193
Alw21I GWGCWC 2 cut(s) 96, 141
AlwI GGATC 2 cut(s) 179, 207
AoxI GGCC 1 cut(s) 80
Bbv12I GWGCWC 2 cut(s) 96, 141
BccI CCATC 1 cut(s) 231
BceAI ACGGC 1 cut(s) 119
BcgI CGANNNNNNTGC 2 cut(s) 76, 110
BmiI GGNNCC 1 cut(s) 70
BsaAI YACGTR 1 cut(s) 321
BsaHI GRCGYC 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 240
BsaWI WCCGGW 1 cut(s) 36
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 78
Bse3DI GCAATG 1 cut(s) 304
BseDI CCNNGG 1 cut(s) 240
BseLI CCNNNNNNNGG 2 cut(s) 43, 78
BseMI GCAATG 1 cut(s) 304
BshFI GGCC 1 cut(s) 82
BsiHKAI GWGCWC 2 cut(s) 96, 141
BsiSI CCGG 1 cut(s) 37
BslI CCNNNNNNNGG 2 cut(s) 43, 78
BsnI GGCC 1 cut(s) 82
Bsp1286I GDGCHC 2 cut(s) 96, 141
Bsp143I GATC 2 cut(s) 184, 212
BspACI CCGC 1 cut(s) 53
BspANI GGCC 1 cut(s) 82
BspLI GGNNCC 1 cut(s) 70
BspPI GGATC 2 cut(s) 179, 207
BsrDI GCAATG 1 cut(s) 304
BssECI CCNNGG 1 cut(s) 240
BssMI GATC 2 cut(s) 184, 212
BssNI GRCGYC 1 cut(s) 30
BssT1I CCWWGG 1 cut(s) 240
Bst4CI ACNGT 1 cut(s) 220
BstACI GRCGYC 1 cut(s) 30
BstBAI YACGTR 1 cut(s) 321
BstC8I GCNNGC 1 cut(s) 149
BstKTI GATC 2 cut(s) 187, 215
BstMBI GATC 2 cut(s) 184, 212
BstNSI RCATGY 1 cut(s) 274
BsuRI GGCC 1 cut(s) 82
Cac8I GCNNGC 1 cut(s) 149
CseI GACGC 1 cut(s) 19
Csp6I GTAC 1 cut(s) 154
CviAII CATG 2 cut(s) 265, 271
CviJI RGCY 5 cut(s) 69, 82, 126, 151, 193
CviKI_1 RGCY 5 cut(s) 69, 82, 126, 151, 193
CviQI GTAC 1 cut(s) 154
DpnI GATC 2 cut(s) 186, 214
DpnII GATC 2 cut(s) 184, 212
EaeI YGGCCR 1 cut(s) 80
EciI GGCGGA 1 cut(s) 68
Eco130I CCWWGG 1 cut(s) 240
Eco32I GATATC 1 cut(s) 247
Eco57I CTGAAG 1 cut(s) 182
EcoRV GATATC 1 cut(s) 247
EcoT14I CCWWGG 1 cut(s) 240
ErhI CCWWGG 1 cut(s) 240
FaeI CATG 2 cut(s) 268, 274
FaiI YATR 5 cut(s) 132, 180, 266, 272, 276
FatI CATG 2 cut(s) 264, 270
HaeIII GGCC 1 cut(s) 82
HapII CCGG 1 cut(s) 37
HgaI GACGC 1 cut(s) 19
Hin1I GRCGYC 1 cut(s) 30
Hin1II CATG 2 cut(s) 268, 274
HinfI GANTC 1 cut(s) 56
HpaII CCGG 1 cut(s) 37
Hpy166II GTNNAC 2 cut(s) 46, 100
Hpy188III TCNNGA 2 cut(s) 22, 188
Hpy8I GTNNAC 2 cut(s) 46, 100
Hpy99I CGWCG 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 220
HpyCH4IV ACGT 1 cut(s) 320
HpyCH4V TGCA 2 cut(s) 64, 268
HpySE526I ACGT 1 cut(s) 320
Hsp92I GRCGYC 1 cut(s) 30
Hsp92II CATG 2 cut(s) 268, 274
Kzo9I GATC 2 cut(s) 184, 212
LmnI GCTCC 1 cut(s) 74
LpnPI CCDG 2 cut(s) 50, 201
MaeII ACGT 1 cut(s) 320
MalI GATC 2 cut(s) 186, 214
MboI GATC 2 cut(s) 184, 212
MboII GAAGA 1 cut(s) 188
MhlI GDGCHC 2 cut(s) 96, 141
MmeI TCCRAC 2 cut(s) 96, 131
MnlI CCTC 2 cut(s) 109, 306
MseI TTAA 1 cut(s) 288
MslI CAYNNNNRTG 2 cut(s) 269, 273
MspI CCGG 1 cut(s) 37
NdeII GATC 2 cut(s) 184, 212
NlaIII CATG 2 cut(s) 268, 274
NlaIV GGNNCC 1 cut(s) 70
NmeAIII GCCGAG 1 cut(s) 58
NspI RCATGY 1 cut(s) 274
PciI ACATGT 1 cut(s) 270
PfeI GAWTC 1 cut(s) 56
PflFI GACNNNGTC 1 cut(s) 116
Ppu21I YACGTR 1 cut(s) 321
PscI ACATGT 1 cut(s) 270
PspN4I GGNNCC 1 cut(s) 70
PsyI GACNNNGTC 1 cut(s) 116
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
RseI CAYNNNNRTG 2 cut(s) 269, 273
SaqAI TTAA 1 cut(s) 288
Sau3AI GATC 2 cut(s) 184, 212
SduI GDGCHC 2 cut(s) 96, 141
SetI ASST 6 cut(s) 93, 120, 128, 153, 195, 323
SmiMI CAYNNNNRTG 2 cut(s) 269, 273
SsiI CCGC 1 cut(s) 53
StyI CCWWGG 1 cut(s) 240
TaaI ACNGT 1 cut(s) 220
TaiI ACGT 1 cut(s) 323
TaqI TCGA 1 cut(s) 141
TatI WGTACW 1 cut(s) 153
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
Tth111I GACNNNGTC 1 cut(s) 116
XceI RCATGY 1 cut(s) 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.