pycom13g14650

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0012182
Physical Location & Seq
Forward (+)
10610338 .. 10611489
1152 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g14650.5

Sequence Viewer

Length: 492 bp
ATGGTGAAACAAAGAGGAGAAGAGTTGACCGAGGACGAAAAGAAGGCCTTAAGAGGCAGCAAATTCGCGCCTCTCCCATCCTTGCCCCCTCCTCGTTGCCAACCCAGGTTGTCTCATCCTGGAGGTCCGTTGACAACGAACAAAGCGGCGGCGTTGGCGAAATTTCTCGAGAGAAAGCTACAGAATCCCGATGGATTGGACTCCATCAATCCGCATCTTCTCGAACGCGCTGTTCAGAACGCTAAACGCACCGTTTTTGCAAGTGGCGCATCGAATTCTGGAATCCGAATACGGCATGTTGACTCCTTTGATGACTCTGAGACTGAGGACCCTCGACGGGAAGAAAATGTGGAGAATTCAGAGCCCAAGAAGGTGAAGAAAAAGAATAAGAAGAAGATGAAAAGTGAGAAGAAAAAGAGACAACAAAAGGTTATGGAAGACTCGGGGTGCGGTGTGGTAAAAAGGCCTAAAAAGAAGAAAGTAAAGTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

164

Amino Acids

18.36

Weight (kDa)

10.1

Isoelectric Point (pI)

52.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012182)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G18540 AT5G18540 AT5G18540 AT5G18540
fragaria_vesca FvH4_4g17670 FvH4_4g17670
malus_domestica MD13G1170800.v1.1
prunus_persica Prupe.1G139200_v2.0.a1
pyrus_communis pycom13g14650
rosa_chinensis RchiOBHm_Chr4g0421611
rosa_laevigata RLG00000007664
rosa_multiflora Rmu_ssc0000097.1_g000003
rosa_roxburghii Rroxscaffold_5G00363860
rosa_rugosa Rorug04G0173800
rosa_samantha Rh4AG233500 Rh4BG236400 Rh4CG248100 Rh4DG232300
rosa_wichuraiana Rw4G020060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 68, 228
AciI CCGC 4 cut(s) 146, 149, 212, 450
AcsI RAATTY 4 cut(s) 62, 161, 274, 355
AfiI CCNNNNNNNGG 1 cut(s) 337
AflII CTTAAG 1 cut(s) 49
AjnI CCWGG 2 cut(s) 104, 118
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
Alw26I GTCTC 3 cut(s) 117, 314, 412
Ama87I CYCGRG 2 cut(s) 167, 442
AoxI GGCC 2 cut(s) 45, 464
ApeKI GCWGC 1 cut(s) 57
ApoI RAATTY 4 cut(s) 62, 161, 274, 355
AspLEI GCGC 3 cut(s) 70, 230, 269
AspS9I GGNCC 2 cut(s) 125, 328
AsuHPI GGTGA 2 cut(s) 16, 385
AvaI CYCGRG 2 cut(s) 167, 442
AvaII GGWCC 2 cut(s) 125, 328
BanII GRGCYC 1 cut(s) 366
BbsI GAAGAC 1 cut(s) 444
BbvI GCAGC 1 cut(s) 69
BccI CCATC 3 cut(s) 85, 185, 212
BceAI ACGGC 1 cut(s) 308
BcgI CGANNNNNNTGC 2 cut(s) 46, 80
BciT130I CCWGG 2 cut(s) 106, 120
BcoDI GTCTC 3 cut(s) 117, 314, 412
BfmI CTRYAG 1 cut(s) 179
BfrI CTTAAG 1 cut(s) 49
BisI GCNGC 3 cut(s) 58, 147, 150
BlsI GCNGC 3 cut(s) 59, 148, 151
Bme1390I CCNGG 2 cut(s) 106, 120
Bme18I GGWCC 2 cut(s) 125, 328
BmeT110I CYCGRG 2 cut(s) 167, 442
BmgT120I GGNCC 2 cut(s) 125, 328
BmiI GGNNCC 1 cut(s) 330
BmrFI CCNGG 2 cut(s) 106, 120
BmsI GCATC 2 cut(s) 223, 278
BpiI GAAGAC 1 cut(s) 444
BpmI CTGGAG 1 cut(s) 141
BsaJI CCNNGG 2 cut(s) 30, 104
Bsc4I CCNNNNNNNGG 1 cut(s) 337
BseBI CCWGG 2 cut(s) 106, 120
BseDI CCNNGG 2 cut(s) 30, 104
BseGI GGATG 2 cut(s) 77, 115
BseLI CCNNNNNNNGG 1 cut(s) 337
BseMII CTCAG 2 cut(s) 309, 315
BseRI GAGGAG 2 cut(s) 30, 81
BseXI GCAGC 1 cut(s) 69
Bsh1236I CGCG 2 cut(s) 68, 228
BshFI GGCC 2 cut(s) 47, 466
BsiHKCI CYCGRG 2 cut(s) 167, 442
BslI CCNNNNNNNGG 1 cut(s) 337
BsmAI GTCTC 3 cut(s) 117, 314, 412
BsnI GGCC 2 cut(s) 47, 466
BsoBI CYCGRG 2 cut(s) 167, 442
Bsp1286I GDGCHC 1 cut(s) 366
BspACI CCGC 4 cut(s) 146, 149, 212, 450
BspANI GGCC 2 cut(s) 47, 466
BspCNI CTCAG 2 cut(s) 310, 316
BspFNI CGCG 2 cut(s) 68, 228
BspLI GGNNCC 1 cut(s) 330
BspTI CTTAAG 1 cut(s) 49
BssECI CCNNGG 2 cut(s) 30, 104
Bst2UI CCWGG 2 cut(s) 106, 120
Bst4CI ACNGT 1 cut(s) 253
Bst6I CTCTTC 1 cut(s) 15
BstAFI CTTAAG 1 cut(s) 49
BstDEI CTNAG 2 cut(s) 318, 324
BstF5I GGATG 2 cut(s) 77, 115
BstFNI CGCG 2 cut(s) 68, 228
BstHHI GCGC 3 cut(s) 70, 230, 269
BstMAI GTCTC 3 cut(s) 117, 314, 412
BstMWI GCNNNNNNNGC 2 cut(s) 155, 266
BstNI CCWGG 2 cut(s) 106, 120
BstNSI RCATGY 1 cut(s) 299
BstSCI CCNGG 2 cut(s) 104, 118
BstSFI CTRYAG 1 cut(s) 179
BstUI CGCG 2 cut(s) 68, 228
BstV1I GCAGC 1 cut(s) 69
BstV2I GAAGAC 1 cut(s) 444
BsuRI GGCC 2 cut(s) 47, 466
BtsCI GGATG 2 cut(s) 77, 115
CfoI GCGC 3 cut(s) 70, 230, 269
Cfr13I GGNCC 2 cut(s) 125, 328
CviAII CATG 1 cut(s) 296
CviJI RGCY 4 cut(s) 47, 178, 364, 466
CviKI_1 RGCY 4 cut(s) 47, 178, 364, 466
DdeI CTNAG 2 cut(s) 318, 324
Eam1104I CTCTTC 1 cut(s) 15
EarI CTCTTC 1 cut(s) 15
Eco147I AGGCCT 2 cut(s) 47, 466
Eco24I GRGCYC 1 cut(s) 366
Eco47I GGWCC 2 cut(s) 125, 328
Eco88I CYCGRG 2 cut(s) 167, 442
EcoO109I RGGNCCY 1 cut(s) 328
EcoRI GAATTC 2 cut(s) 274, 355
EcoRII CCWGG 2 cut(s) 104, 118
EcoT38I GRGCYC 1 cut(s) 366
FaeI CATG 1 cut(s) 299
FaiI YATR 2 cut(s) 297, 434
FalI AAGNNNNNCTT 2 cut(s) 32, 64
FatI CATG 1 cut(s) 295
Fnu4HI GCNGC 3 cut(s) 58, 147, 150
FokI GGATG 2 cut(s) 64, 102
FriOI GRGCYC 1 cut(s) 366
Fsp4HI GCNGC 3 cut(s) 58, 147, 150
GlaI GCGC 3 cut(s) 69, 229, 268
GluI GCNGC 3 cut(s) 58, 147, 150
GsuI CTGGAG 1 cut(s) 141
HaeIII GGCC 2 cut(s) 47, 466
HhaI GCGC 3 cut(s) 70, 230, 269
Hin1II CATG 1 cut(s) 299
Hin6I GCGC 3 cut(s) 68, 228, 267
HinP1I GCGC 3 cut(s) 68, 228, 267
HincII GTYRAC 3 cut(s) 27, 132, 301
HindII GTYRAC 3 cut(s) 27, 132, 301
HinfI GANTC 6 cut(s) 184, 200, 282, 302, 314, 440
HphI GGTGA 2 cut(s) 16, 385
Hpy166II GTNNAC 3 cut(s) 27, 132, 301
Hpy188I TCNGA 4 cut(s) 237, 287, 319, 361
Hpy188III TCNNGA 5 cut(s) 167, 169, 188, 221, 279
Hpy8I GTNNAC 3 cut(s) 27, 132, 301
Hpy99I CGWCG 1 cut(s) 339
HpyAV CCTTC 2 cut(s) 37, 364
HpyCH4III ACNGT 1 cut(s) 253
HpyCH4V TGCA 1 cut(s) 260
HpyF10VI GCNNNNNNNGC 2 cut(s) 155, 266
HpyF3I CTNAG 2 cut(s) 318, 324
Hsp92II CATG 1 cut(s) 299
HspAI GCGC 3 cut(s) 68, 228, 267
LpnPI CCDG 5 cut(s) 91, 105, 118, 132, 264
Lsp1109I GCAGC 1 cut(s) 69
LweI GCATC 2 cut(s) 223, 278
MboII GAAGA 9 cut(s) 32, 209, 353, 388, 403, 406, 421, 449, 487
MhlI GDGCHC 1 cut(s) 366
MluCI AATT 4 cut(s) 62, 161, 274, 355
MlyI GAGTC 4 cut(s) 194, 296, 308, 434
MnlI CCTC 9 cut(s) 8, 25, 47, 81, 99, 102, 116, 319, 342
MseI TTAA 1 cut(s) 50
MspCI CTTAAG 1 cut(s) 49
MspR9I CCNGG 2 cut(s) 106, 120
MvaI CCWGG 2 cut(s) 106, 120
MvnI CGCG 2 cut(s) 68, 228
MwoI GCNNNNNNNGC 2 cut(s) 155, 266
NlaIII CATG 1 cut(s) 299
NlaIV GGNNCC 1 cut(s) 330
NspI RCATGY 1 cut(s) 299
PaeR7I CTCGAG 1 cut(s) 167
PceI AGGCCT 2 cut(s) 47, 466
PfeI GAWTC 2 cut(s) 184, 282
PfoI TCCNGGA 1 cut(s) 118
PkrI GCNGC 3 cut(s) 59, 148, 151
PleI GAGTC 4 cut(s) 194, 296, 308, 434
PpsI GAGTC 4 cut(s) 194, 296, 308, 434
PpuMI RGGWCCY 1 cut(s) 328
Psp5II RGGWCCY 1 cut(s) 328
Psp6I CCWGG 2 cut(s) 104, 118
PspGI CCWGG 2 cut(s) 104, 118
PspN4I GGNNCC 1 cut(s) 330
PspPI GGNCC 2 cut(s) 125, 328
PspPPI RGGWCCY 1 cut(s) 328
SaqAI TTAA 1 cut(s) 50
SatI GCNGC 3 cut(s) 58, 147, 150
Sau96I GGNCC 2 cut(s) 125, 328
SchI GAGTC 4 cut(s) 194, 296, 308, 434
ScrFI CCNGG 2 cut(s) 106, 120
SduI GDGCHC 1 cut(s) 366
SetI ASST 5 cut(s) 110, 127, 180, 375, 432
SfaNI GCATC 2 cut(s) 223, 278
SfcI CTRYAG 1 cut(s) 179
Sfr274I CTCGAG 1 cut(s) 167
SinI GGWCC 2 cut(s) 125, 328
SlaI CTCGAG 1 cut(s) 167
SmlI CTYRAG 2 cut(s) 49, 167
SmoI CTYRAG 2 cut(s) 49, 167
Sse9I AATT 4 cut(s) 62, 161, 274, 355
SseBI AGGCCT 2 cut(s) 47, 466
SsiI CCGC 4 cut(s) 146, 149, 212, 450
StuI AGGCCT 2 cut(s) 47, 466
StyD4I CCNGG 2 cut(s) 104, 118
TaaI ACNGT 1 cut(s) 253
TaqI TCGA 4 cut(s) 168, 222, 272, 334
TaqII GACCGA 1 cut(s) 44
TasI AATT 4 cut(s) 62, 161, 274, 355
TauI GCSGC 2 cut(s) 149, 152
TfiI GAWTC 2 cut(s) 184, 282
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TseI GCWGC 1 cut(s) 57
TspDTI ATGAA 1 cut(s) 413
TspGWI ACGGA 1 cut(s) 117
Vha464I CTTAAG 1 cut(s) 49
VpaK11BI GGWCC 2 cut(s) 125, 328
XapI RAATTY 4 cut(s) 62, 161, 274, 355
XceI RCATGY 1 cut(s) 299
XhoI CTCGAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.