Rh4CG248100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0012182
Physical Location & Seq
Reverse (-)
49795388 .. 49796944
1557 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG248100.1

Sequence Viewer

Length: 324 bp
ATGGCCAAGGACAGAGCAGAAGAGTTGAGCGAAGACGAAAAGAGGGCCTTAAGAGGCAGCAAATTCGCTCCTCTCCCATCTTTACCGCCTCCTCGATCCCAACCCAGGTTGGCTCATCCAGGGGGTCCGTTGACGACGAACAAGGCGGCGGCGTTGGCGAAATTTCTAGAAAGAAAGCTGCAGGATCCGGATGGATTGGGCACCATGAATCCACAGCTAGTTGAACGCGCTGTTCAGAACGCAAAACGCACCGTTTTCGCAAGTAAAACCCTAAACTCAATTTGGTGTTACGGTAATCAAAGATTTAAGCTTCAAATGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.91

Weight (kDa)

10.16

Isoelectric Point (pI)

44.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012182)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G18540 AT5G18540 AT5G18540 AT5G18540
fragaria_vesca FvH4_4g17670 FvH4_4g17670
malus_domestica MD13G1170800.v1.1
prunus_persica Prupe.1G139200_v2.0.a1
pyrus_communis pycom13g14650
rosa_chinensis RchiOBHm_Chr4g0421611
rosa_laevigata RLG00000007664
rosa_multiflora Rmu_ssc0000097.1_g000003
rosa_roxburghii Rroxscaffold_5G00363860
rosa_rugosa Rorug04G0173800
rosa_samantha Rh4AG233500 Rh4BG236400 Rh4CG248100 Rh4DG232300
rosa_wichuraiana Rw4G020060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 200
AccII CGCG 1 cut(s) 228
AccIII TCCGGA 1 cut(s) 187
AciI CCGC 3 cut(s) 86, 146, 149
AclWI GGATC 3 cut(s) 90, 179, 192
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 62, 161
AfiI CCNNNNNNNGG 1 cut(s) 105
AflII CTTAAG 1 cut(s) 49
AgsI TTSAA 2 cut(s) 224, 314
AjnI CCWGG 2 cut(s) 104, 118
AluBI AGCT 3 cut(s) 178, 217, 310
AluI AGCT 3 cut(s) 178, 217, 310
AlwI GGATC 3 cut(s) 90, 179, 192
Aor13HI TCCGGA 1 cut(s) 187
AoxI GGCC 2 cut(s) 3, 45
ApeKI GCWGC 2 cut(s) 57, 178
ApoI RAATTY 2 cut(s) 62, 161
AspLEI GCGC 1 cut(s) 230
AspS9I GGNCC 2 cut(s) 45, 125
AvaII GGWCC 1 cut(s) 125
BaeGI GKGCMC 1 cut(s) 203
BalI TGGCCA 1 cut(s) 5
BamHI GGATCC 1 cut(s) 184
BanI GGYRCC 1 cut(s) 200
BbsI GAAGAC 1 cut(s) 39
BbvI GCAGC 2 cut(s) 69, 165
BccI CCATC 2 cut(s) 85, 185
BcgI CGANNNNNNTGC 4 cut(s) 46, 80, 238, 272
BciT130I CCWGG 2 cut(s) 106, 120
BfaI CTAG 2 cut(s) 167, 218
BfmI CTRYAG 1 cut(s) 179
BfrI CTTAAG 1 cut(s) 49
BisI GCNGC 4 cut(s) 58, 147, 150, 179
BlsI GCNGC 4 cut(s) 59, 148, 151, 180
Bme1390I CCNGG 2 cut(s) 106, 120
Bme18I GGWCC 1 cut(s) 125
BmgT120I GGNCC 2 cut(s) 45, 125
BmiI GGNNCC 3 cut(s) 126, 186, 202
BmrFI CCNGG 2 cut(s) 106, 120
BpiI GAAGAC 1 cut(s) 39
BsaJI CCNNGG 3 cut(s) 6, 104, 119
BsaWI WCCGGW 1 cut(s) 187
Bsc4I CCNNNNNNNGG 1 cut(s) 105
BseAI TCCGGA 1 cut(s) 187
BseBI CCWGG 2 cut(s) 106, 120
BseDI CCNNGG 3 cut(s) 6, 104, 119
BseGI GGATG 2 cut(s) 115, 196
BseLI CCNNNNNNNGG 1 cut(s) 105
BseRI GAGGAG 2 cut(s) 60, 81
BseSI GKGCMC 1 cut(s) 203
BseXI GCAGC 2 cut(s) 69, 165
Bsh1236I CGCG 1 cut(s) 228
BshFI GGCC 2 cut(s) 5, 47
BshNI GGYRCC 1 cut(s) 200
BsiSI CCGG 1 cut(s) 188
BslI CCNNNNNNNGG 1 cut(s) 105
BsnI GGCC 2 cut(s) 5, 47
Bsp1286I GDGCHC 1 cut(s) 203
Bsp13I TCCGGA 1 cut(s) 187
Bsp143I GATC 2 cut(s) 95, 184
BspACI CCGC 3 cut(s) 86, 146, 149
BspANI GGCC 2 cut(s) 5, 47
BspEI TCCGGA 1 cut(s) 187
BspFNI CGCG 1 cut(s) 228
BspLI GGNNCC 3 cut(s) 126, 186, 202
BspMAI CTGCAG 1 cut(s) 183
BspPI GGATC 3 cut(s) 90, 179, 192
BspT107I GGYRCC 1 cut(s) 200
BspTI CTTAAG 1 cut(s) 49
BssECI CCNNGG 3 cut(s) 6, 104, 119
BssMI GATC 2 cut(s) 95, 184
BssT1I CCWWGG 1 cut(s) 6
Bst2UI CCWGG 2 cut(s) 106, 120
Bst4CI ACNGT 2 cut(s) 253, 293
Bst6I CTCTTC 1 cut(s) 15
BstAFI CTTAAG 1 cut(s) 49
BstF5I GGATG 2 cut(s) 115, 196
BstFNI CGCG 1 cut(s) 228
BstHHI GCGC 1 cut(s) 230
BstKTI GATC 2 cut(s) 98, 187
BstMBI GATC 2 cut(s) 95, 184
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstNI CCWGG 2 cut(s) 106, 120
BstSCI CCNGG 2 cut(s) 104, 118
BstSFI CTRYAG 1 cut(s) 179
BstSLI GKGCMC 1 cut(s) 203
BstUI CGCG 1 cut(s) 228
BstV1I GCAGC 2 cut(s) 69, 165
BstV2I GAAGAC 1 cut(s) 39
BstX2I RGATCY 1 cut(s) 184
BstYI RGATCY 1 cut(s) 184
BsuRI GGCC 2 cut(s) 5, 47
BtsCI GGATG 2 cut(s) 115, 196
CfoI GCGC 1 cut(s) 230
Cfr13I GGNCC 2 cut(s) 45, 125
CviAII CATG 1 cut(s) 205
CviJI RGCY 6 cut(s) 5, 47, 113, 178, 217, 310
CviKI_1 RGCY 6 cut(s) 5, 47, 113, 178, 217, 310
DpnI GATC 2 cut(s) 97, 186
DpnII GATC 2 cut(s) 95, 184
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 15
EarI CTCTTC 1 cut(s) 15
Eco130I CCWWGG 1 cut(s) 6
Eco47I GGWCC 1 cut(s) 125
EcoO109I RGGNCCY 1 cut(s) 45
EcoRII CCWGG 2 cut(s) 104, 118
EcoT14I CCWWGG 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 6
FaeI CATG 1 cut(s) 208
FaiI YATR 1 cut(s) 206
FalI AAGNNNNNCTT 2 cut(s) 32, 64
FatI CATG 1 cut(s) 204
Fnu4HI GCNGC 4 cut(s) 58, 147, 150, 179
FokI GGATG 2 cut(s) 102, 203
Fsp4HI GCNGC 4 cut(s) 58, 147, 150, 179
FspBI CTAG 2 cut(s) 167, 218
GlaI GCGC 1 cut(s) 229
GluI GCNGC 4 cut(s) 58, 147, 150, 179
HaeIII GGCC 2 cut(s) 5, 47
HapII CCGG 1 cut(s) 188
HhaI GCGC 1 cut(s) 230
Hin1II CATG 1 cut(s) 208
Hin6I GCGC 1 cut(s) 228
HinP1I GCGC 1 cut(s) 228
HincII GTYRAC 1 cut(s) 132
HindII GTYRAC 1 cut(s) 132
HindIII AAGCTT 1 cut(s) 308
HinfI GANTC 1 cut(s) 208
HpaII CCGG 1 cut(s) 188
Hpy166II GTNNAC 1 cut(s) 132
Hpy188I TCNGA 1 cut(s) 237
Hpy188III TCNNGA 2 cut(s) 167, 188
Hpy8I GTNNAC 1 cut(s) 132
Hpy99I CGWCG 1 cut(s) 139
HpyCH4III ACNGT 2 cut(s) 253, 293
HpyCH4V TGCA 1 cut(s) 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
Hsp92II CATG 1 cut(s) 208
HspAI GCGC 1 cut(s) 228
Kpn2I TCCGGA 1 cut(s) 187
Kzo9I GATC 2 cut(s) 95, 184
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 6 cut(s) 91, 105, 118, 132, 167, 201
Lsp1109I GCAGC 2 cut(s) 69, 165
MaeI CTAG 2 cut(s) 167, 218
MaeIII GTNAC 1 cut(s) 287
MalI GATC 2 cut(s) 97, 186
MboI GATC 2 cut(s) 95, 184
MboII GAAGA 2 cut(s) 32, 44
MflI RGATCY 1 cut(s) 184
MhlI GDGCHC 1 cut(s) 203
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 62, 161, 279
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 5 cut(s) 36, 47, 81, 99, 102
Mox20I TGGCCA 1 cut(s) 5
MroI TCCGGA 1 cut(s) 187
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 50, 306
Msp20I TGGCCA 1 cut(s) 5
MspCI CTTAAG 1 cut(s) 49
MspI CCGG 1 cut(s) 188
MspR9I CCNGG 2 cut(s) 106, 120
MvaI CCWGG 2 cut(s) 106, 120
MvnI CGCG 1 cut(s) 228
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 2 cut(s) 95, 184
NlaIII CATG 1 cut(s) 208
NlaIV GGNNCC 3 cut(s) 126, 186, 202
PfeI GAWTC 1 cut(s) 208
PkrI GCNGC 4 cut(s) 59, 148, 151, 180
Psp6I CCWGG 2 cut(s) 104, 118
PspGI CCWGG 2 cut(s) 104, 118
PspN4I GGNNCC 3 cut(s) 126, 186, 202
PspPI GGNCC 2 cut(s) 45, 125
PstI CTGCAG 1 cut(s) 183
PsuI RGATCY 1 cut(s) 184
SaqAI TTAA 2 cut(s) 50, 306
SatI GCNGC 4 cut(s) 58, 147, 150, 179
Sau3AI GATC 2 cut(s) 95, 184
Sau96I GGNCC 2 cut(s) 45, 125
ScrFI CCNGG 2 cut(s) 106, 120
SduI GDGCHC 1 cut(s) 203
SetI ASST 4 cut(s) 110, 180, 219, 312
SfcI CTRYAG 1 cut(s) 179
SinI GGWCC 1 cut(s) 125
SmlI CTYRAG 1 cut(s) 49
SmoI CTYRAG 1 cut(s) 49
Sse9I AATT 3 cut(s) 62, 161, 279
SsiI CCGC 3 cut(s) 86, 146, 149
SspMI CTAG 2 cut(s) 167, 218
StyD4I CCNGG 2 cut(s) 104, 118
StyI CCWWGG 1 cut(s) 6
TaaI ACNGT 2 cut(s) 253, 293
TaqI TCGA 1 cut(s) 94
TasI AATT 3 cut(s) 62, 161, 279
TauI GCSGC 2 cut(s) 149, 152
TfiI GAWTC 1 cut(s) 208
Tru1I TTAA 2 cut(s) 50, 306
Tru9I TTAA 2 cut(s) 50, 306
TseI GCWGC 2 cut(s) 57, 178
TspDTI ATGAA 1 cut(s) 221
TspGWI ACGGA 1 cut(s) 117
Vha464I CTTAAG 1 cut(s) 49
VpaK11BI GGWCC 1 cut(s) 125
XapI RAATTY 2 cut(s) 62, 161
XbaI TCTAGA 1 cut(s) 166
XspI CTAG 2 cut(s) 167, 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.