pycom13g14880

Belongs to the DEAD box helicase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
10758458 .. 10758697
240 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g14880.1

Sequence Viewer

Length: 240 bp
ATGCAGAAACGCATCCCTTCCCCGCAACCCCCCACCCCTCTCCTCTACTCAGTTCACCTCCCCCAACCGATCTATGCCGTCGAGTTCCCTCTCTTCAAACCTTGGGCCCCCAAATCCCCAAAACCCTCAAAAAACCTTATTCCTGCCGCAATTGCCGCACCCTCCACCCCTAACCTCCAAATCGAAATATCCATAAATCCTAACCCCGACTCTGCCGCCACATTCACCCCGAAATCCTAG

Protein Analysis

80

Amino Acids

8.59

Weight (kDa)

9.78

Isoelectric Point (pI)

66.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 23, 147, 156, 216
AgsI TTSAA 1 cut(s) 97
AoxI GGCC 1 cut(s) 105
ApaI GGGCCC 1 cut(s) 109
AspS9I GGNCC 2 cut(s) 105, 106
AsuHPI GGTGA 2 cut(s) 47, 217
BaeGI GKGCMC 1 cut(s) 109
BanII GRGCYC 1 cut(s) 109
BceAI ACGGC 1 cut(s) 62
BfaI CTAG 1 cut(s) 238
BisI GCNGC 3 cut(s) 147, 156, 216
BlsI GCNGC 3 cut(s) 148, 157, 217
BmgT120I GGNCC 2 cut(s) 105, 106
BmiI GGNNCC 2 cut(s) 107, 108
BmsI GCATC 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 101
BseDI CCNNGG 1 cut(s) 101
BseGI GGATG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 63
BseRI GAGGAG 1 cut(s) 32
BseSI GKGCMC 1 cut(s) 109
BshFI GGCC 1 cut(s) 107
BsnI GGCC 1 cut(s) 107
Bsp120I GGGCCC 1 cut(s) 105
Bsp1286I GDGCHC 1 cut(s) 109
Bsp143I GATC 1 cut(s) 69
BspACI CCGC 4 cut(s) 23, 147, 156, 216
BspANI GGCC 1 cut(s) 107
BspCNI CTCAG 1 cut(s) 62
BspLI GGNNCC 2 cut(s) 107, 108
BssECI CCNNGG 1 cut(s) 101
BssMI GATC 1 cut(s) 69
BssT1I CCWWGG 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 98
BstDEI CTNAG 1 cut(s) 49
BstF5I GGATG 1 cut(s) 12
BstKTI GATC 1 cut(s) 72
BstMBI GATC 1 cut(s) 69
BstMWI GCNNNNNNNGC 2 cut(s) 152, 155
BstSLI GKGCMC 1 cut(s) 109
BsuRI GGCC 1 cut(s) 107
BtsCI GGATG 1 cut(s) 12
Cfr13I GGNCC 2 cut(s) 105, 106
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
DdeI CTNAG 1 cut(s) 49
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
Eam1104I CTCTTC 1 cut(s) 98
EarI CTCTTC 1 cut(s) 98
Eco130I CCWWGG 1 cut(s) 101
Eco24I GRGCYC 1 cut(s) 109
EcoO109I RGGNCCY 1 cut(s) 106
EcoT14I CCWWGG 1 cut(s) 101
EcoT38I GRGCYC 1 cut(s) 109
ErhI CCWWGG 1 cut(s) 101
FaiI YATR 2 cut(s) 75, 194
FauI CCCGC 1 cut(s) 30
Fnu4HI GCNGC 3 cut(s) 147, 156, 216
FriOI GRGCYC 1 cut(s) 109
Fsp4HI GCNGC 3 cut(s) 147, 156, 216
FspBI CTAG 1 cut(s) 238
GluI GCNGC 3 cut(s) 147, 156, 216
HaeIII GGCC 1 cut(s) 107
HinfI GANTC 1 cut(s) 209
HphI GGTGA 2 cut(s) 47, 217
Hpy166II GTNNAC 1 cut(s) 55
Hpy8I GTNNAC 1 cut(s) 55
Hpy99I CGWCG 1 cut(s) 83
HpyAV CCTTC 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 2 cut(s) 152, 155
HpyF3I CTNAG 1 cut(s) 49
Kzo9I GATC 1 cut(s) 69
LpnPI CCDG 1 cut(s) 156
LweI GCATC 1 cut(s) 21
MaeI CTAG 1 cut(s) 238
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MboII GAAGA 1 cut(s) 85
MfeI CAATTG 1 cut(s) 150
MhlI GDGCHC 1 cut(s) 109
MluCI AATT 1 cut(s) 150
MlyI GAGTC 1 cut(s) 203
MnlI CCTC 7 cut(s) 48, 53, 68, 99, 136, 172, 185
MunI CAATTG 1 cut(s) 150
MwoI GCNNNNNNNGC 2 cut(s) 152, 155
NdeII GATC 1 cut(s) 69
NlaIV GGNNCC 2 cut(s) 107, 108
PkrI GCNGC 3 cut(s) 148, 157, 217
PleI GAGTC 1 cut(s) 203
PpsI GAGTC 1 cut(s) 203
PspN4I GGNNCC 2 cut(s) 107, 108
PspOMI GGGCCC 1 cut(s) 105
PspPI GGNCC 2 cut(s) 105, 106
SatI GCNGC 3 cut(s) 147, 156, 216
Sau3AI GATC 1 cut(s) 69
Sau96I GGNCC 2 cut(s) 105, 106
SchI GAGTC 1 cut(s) 203
SduI GDGCHC 1 cut(s) 109
SetI ASST 4 cut(s) 60, 103, 138, 177
SfaNI GCATC 1 cut(s) 21
SgeI CNNG 5 cut(s) 34, 94, 114, 155, 218
Sse9I AATT 1 cut(s) 150
SsiI CCGC 4 cut(s) 23, 147, 156, 216
SspMI CTAG 1 cut(s) 238
StyI CCWWGG 1 cut(s) 101
TaqI TCGA 2 cut(s) 81, 183
TasI AATT 1 cut(s) 150
TauI GCSGC 3 cut(s) 149, 158, 218
XspI CTAG 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.