pycom14g09620

Elicitor-responsive protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
11638995 .. 11639881
887 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 324 bp
ATGCCTCGAGGAACTCTTGAAGTTAACCTTGTTAATGCCAAGGGCCTTAAAAACACAGAGTTTTTTGGGTCCAATCCAGAATGGAATGAGAGCTTTGTATTCGGTGTCGCTGATGGTGTGACAGAACTCCACTTGATGATCATGGACAAGGATACTGGTTCCGCCGATGACTTTGTGGGAGAATTAAGTATTCCACTAAGAACAATATATGAGGAAGGGAAACTACCACCAATGAAATACAATGTCCTAAGGAACAAAAAGTACCGCGGAGAGATTAAAATCGGATTCACGTTCACTCCAGCGGTAATTTTTCTTTTTCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.1

Weight (kDa)

5.64

Isoelectric Point (pI)

18.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
C2 PF00168 24 - 74 1.6e-11 C2 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015617)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 6
AccII CGCG 1 cut(s) 267
AciI CCGC 4 cut(s) 162, 265, 267, 302
AfaI GTAC 1 cut(s) 263
AgsI TTSAA 1 cut(s) 20
AluBI AGCT 1 cut(s) 93
AluI AGCT 1 cut(s) 93
Ama87I CYCGRG 1 cut(s) 6
AoxI GGCC 1 cut(s) 43
AspS9I GGNCC 2 cut(s) 43, 69
AvaI CYCGRG 1 cut(s) 6
AvaII GGWCC 1 cut(s) 69
AxyI CCTNAGG 1 cut(s) 248
BarI GAAGNNNNNNTAC 2 cut(s) 207, 239
BccI CCATC 1 cut(s) 107
BciVI GTATCC 1 cut(s) 145
BclI TGATCA 1 cut(s) 138
BfuI GTATCC 1 cut(s) 145
Bme18I GGWCC 1 cut(s) 69
BmeT110I CYCGRG 1 cut(s) 6
BmgT120I GGNCC 2 cut(s) 43, 69
BmiI GGNNCC 2 cut(s) 70, 160
BpmI CTGGAG 1 cut(s) 282
BsaBI GATNNNNATC 1 cut(s) 278
BsaJI CCNNGG 2 cut(s) 39, 265
BsaXI ACNNNNNCTCC 2 cut(s) 280, 310
Bse1I ACTGG 1 cut(s) 160
Bse21I CCTNAGG 1 cut(s) 248
Bse8I GATNNNNATC 1 cut(s) 278
BseDI CCNNGG 2 cut(s) 39, 265
BseJI GATNNNNATC 1 cut(s) 278
BseNI ACTGG 1 cut(s) 160
Bsh1236I CGCG 1 cut(s) 267
BshFI GGCC 1 cut(s) 45
BsiHKCI CYCGRG 1 cut(s) 6
BsnI GGCC 1 cut(s) 45
BsoBI CYCGRG 1 cut(s) 6
Bsp143I GATC 1 cut(s) 138
BspACI CCGC 4 cut(s) 162, 265, 267, 302
BspANI GGCC 1 cut(s) 45
BspFNI CGCG 1 cut(s) 267
BspLI GGNNCC 2 cut(s) 70, 160
BsrI ACTGG 1 cut(s) 160
BssECI CCNNGG 2 cut(s) 39, 265
BssMI GATC 1 cut(s) 138
BssT1I CCWWGG 1 cut(s) 39
BstDEI CTNAG 2 cut(s) 197, 248
BstDSI CCRYGG 1 cut(s) 265
BstFNI CGCG 1 cut(s) 267
BstKTI GATC 1 cut(s) 141
BstMBI GATC 1 cut(s) 138
BstUI CGCG 1 cut(s) 267
Bsu36I CCTNAGG 1 cut(s) 248
BsuI GTATCC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 45
BtgI CCRYGG 1 cut(s) 265
Cfr13I GGNCC 2 cut(s) 43, 69
Cfr42I CCGCGG 1 cut(s) 268
Csp6I GTAC 1 cut(s) 262
CviAII CATG 1 cut(s) 142
CviJI RGCY 2 cut(s) 45, 93
CviKI_1 RGCY 2 cut(s) 45, 93
CviQI GTAC 1 cut(s) 262
DdeI CTNAG 2 cut(s) 197, 248
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
EciI GGCGGA 1 cut(s) 151
Eco130I CCWWGG 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 69
Eco81I CCTNAGG 1 cut(s) 248
Eco88I CYCGRG 1 cut(s) 6
EcoO109I RGGNCCY 1 cut(s) 43
EcoT14I CCWWGG 1 cut(s) 39
ErhI CCWWGG 1 cut(s) 39
FaeI CATG 1 cut(s) 145
FaiI YATR 3 cut(s) 143, 208, 210
FalI AAGNNNNNCTT 2 cut(s) 12, 44
FatI CATG 1 cut(s) 141
FbaI TGATCA 1 cut(s) 138
GsuI CTGGAG 1 cut(s) 282
HaeIII GGCC 1 cut(s) 45
Hin1II CATG 1 cut(s) 145
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HinfI GANTC 1 cut(s) 285
HpaI GTTAAC 1 cut(s) 25
Hpy166II GTNNAC 2 cut(s) 25, 294
Hpy188I TCNGA 1 cut(s) 284
Hpy188III TCNNGA 2 cut(s) 17, 77
Hpy8I GTNNAC 2 cut(s) 25, 294
HpyAV CCTTC 1 cut(s) 209
HpyCH4IV ACGT 1 cut(s) 290
HpyF3I CTNAG 2 cut(s) 197, 248
HpySE526I ACGT 1 cut(s) 290
Hsp92II CATG 1 cut(s) 145
Ksp22I TGATCA 1 cut(s) 138
KspAI GTTAAC 1 cut(s) 25
KspI CCGCGG 1 cut(s) 268
Kzo9I GATC 1 cut(s) 138
LpnPI CCDG 3 cut(s) 90, 141, 312
MaeII ACGT 1 cut(s) 290
MaeIII GTNAC 1 cut(s) 118
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MluCI AATT 2 cut(s) 182, 306
MnlI CCTC 2 cut(s) 15, 205
MseI TTAA 5 cut(s) 24, 33, 48, 185, 276
MspA1I CMGCKG 2 cut(s) 267, 302
MvnI CGCG 1 cut(s) 267
NdeII GATC 1 cut(s) 138
NlaIII CATG 1 cut(s) 145
NlaIV GGNNCC 2 cut(s) 70, 160
NmuCI GTSAC 1 cut(s) 118
PaeR7I CTCGAG 1 cut(s) 6
PfeI GAWTC 1 cut(s) 285
PspN4I GGNNCC 2 cut(s) 70, 160
PspPI GGNCC 2 cut(s) 43, 69
PspXI VCTCGAGB 1 cut(s) 6
PsrI GAACNNNNNNTAC 2 cut(s) 245, 277
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
SacII CCGCGG 1 cut(s) 268
SaqAI TTAA 5 cut(s) 24, 33, 48, 185, 276
Sau3AI GATC 1 cut(s) 138
Sau96I GGNCC 2 cut(s) 43, 69
SetI ASST 3 cut(s) 30, 95, 293
Sfr274I CTCGAG 1 cut(s) 6
Sfr303I CCGCGG 1 cut(s) 268
SgrBI CCGCGG 1 cut(s) 268
SinI GGWCC 1 cut(s) 69
SlaI CTCGAG 1 cut(s) 6
SmlI CTYRAG 1 cut(s) 6
SmoI CTYRAG 1 cut(s) 6
Sse9I AATT 2 cut(s) 182, 306
SsiI CCGC 4 cut(s) 162, 265, 267, 302
StyI CCWWGG 1 cut(s) 39
TaiI ACGT 1 cut(s) 293
TaqI TCGA 1 cut(s) 7
TasI AATT 2 cut(s) 182, 306
TfiI GAWTC 1 cut(s) 285
Tru1I TTAA 5 cut(s) 24, 33, 48, 185, 276
Tru9I TTAA 5 cut(s) 24, 33, 48, 185, 276
TseFI GTSAC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 118
TspDTI ATGAA 2 cut(s) 248, 308
VpaK11BI GGWCC 1 cut(s) 69
XhoI CTCGAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.