Rh7DG175900

Elicitor-responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0015617
Physical Location & Seq
Reverse (-)
16108554 .. 16110370
1817 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG175900.1

Sequence Viewer

Length: 429 bp
ATGCCTCAAGGAACCTTAGACGTTCAACTTATGAAGGCCAAGGGTCTAAAAAACACAGAGTTCTTTGGTAAGATGGATCCTTACGTCATTCTCAAGTGCAAAAACCAGGAAAAAAGGAGCAAAGTGGCAACATCACAAGGGTCTAACCCAGAATGGAATGAGAAGTTTGTTTTCCGAGTAACTGAGGGTGTTACTGAACTCAAAATGACGATCATGGACAAGGACACCGCTACCAGGGATGATTTTGTAGGAGAGTTAAGCATTCCACTAAAAACACTATTCCAAGAAGGGAAACTCCCACCAATGAAATACAATGTACTAAGGAACAAAAAATACTACGGAGAGATTAAAGTTGGCCTTAGCTTCACTCCTTCAACGAACACTACAGACATCCCGGACGGCGTACAATCAAGGCGAATGCTCAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C2

Protein Analysis

142

Amino Acids

16.23

Weight (kDa)

9.52

Isoelectric Point (pI)

36.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
C2 PF00168 4 - 98 2e-25 C2 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015617)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g01841
malus_domestica MD14G1098100.v1.1
prunus_persica Prupe.5G094600_v2.0.a1
pyrus_communis pycom14g09620
rosa_chinensis RchiOBHm_Chr7g0198691
rosa_laevigata RLG00000003845
rosa_roxburghii Rroxscaffold_3G00257500
rosa_rugosa Rorug07G0049500 Rorug07G0049600 Rorug07G0049700 Rorug07G0049800
rosa_samantha Rh7AG173200 Rh7BG176600 Rh7CG182500 Rh7DG175900
rosa_wichuraiana Rw7G015170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 228
AclWI GGATC 2 cut(s) 71, 84
AfaI GTAC 2 cut(s) 318, 405
AfiI CCNNNNNNNGG 1 cut(s) 234
AgsI TTSAA 2 cut(s) 26, 375
AjnI CCWGG 2 cut(s) 105, 233
AluBI AGCT 1 cut(s) 363
AluI AGCT 1 cut(s) 363
AlwI GGATC 2 cut(s) 71, 84
AoxI GGCC 2 cut(s) 36, 355
AsuC2I CCSGG 1 cut(s) 395
BamHI GGATCC 1 cut(s) 76
BccI CCATC 1 cut(s) 67
BceAI ACGGC 1 cut(s) 415
BciT130I CCWGG 2 cut(s) 107, 235
BcnI CCSGG 1 cut(s) 395
BfmI CTRYAG 1 cut(s) 384
Bme1390I CCNGG 3 cut(s) 107, 235, 395
BmiI GGNNCC 2 cut(s) 13, 78
BmrFI CCNGG 3 cut(s) 107, 235, 395
Bpu10I CCTNAGC 2 cut(s) 359, 422
BpuEI CTTGAG 1 cut(s) 77
BpuMI CCSGG 1 cut(s) 395
BsaJI CCNNGG 2 cut(s) 39, 234
Bsc4I CCNNNNNNNGG 1 cut(s) 234
BseBI CCWGG 2 cut(s) 107, 235
BseDI CCNNGG 2 cut(s) 39, 234
BseGI GGATG 2 cut(s) 244, 390
BseLI CCNNNNNNNGG 1 cut(s) 234
BseMII CTCAG 1 cut(s) 174
BshFI GGCC 2 cut(s) 38, 357
BsiSI CCGG 1 cut(s) 395
BslI CCNNNNNNNGG 1 cut(s) 234
BsmI GAATGC 2 cut(s) 261, 423
BsnI GGCC 2 cut(s) 38, 357
Bsp143I GATC 2 cut(s) 76, 210
BspACI CCGC 1 cut(s) 228
BspANI GGCC 2 cut(s) 38, 357
BspCNI CTCAG 1 cut(s) 175
BspLI GGNNCC 2 cut(s) 13, 78
BspPI GGATC 2 cut(s) 71, 84
BssECI CCNNGG 2 cut(s) 39, 234
BssMI GATC 2 cut(s) 76, 210
BssT1I CCWWGG 1 cut(s) 39
Bst2UI CCWGG 2 cut(s) 107, 235
BstDEI CTNAG 5 cut(s) 16, 183, 320, 359, 422
BstF5I GGATG 2 cut(s) 244, 390
BstKTI GATC 2 cut(s) 79, 213
BstMBI GATC 2 cut(s) 76, 210
BstNI CCWGG 2 cut(s) 107, 235
BstSCI CCNGG 3 cut(s) 105, 233, 393
BstSFI CTRYAG 1 cut(s) 384
BstX2I RGATCY 1 cut(s) 76
BstYI RGATCY 1 cut(s) 76
BsuRI GGCC 2 cut(s) 38, 357
BtsCI GGATG 2 cut(s) 244, 390
Csp6I GTAC 2 cut(s) 317, 404
CviAII CATG 1 cut(s) 214
CviJI RGCY 3 cut(s) 38, 357, 363
CviKI_1 RGCY 3 cut(s) 38, 357, 363
CviQI GTAC 2 cut(s) 317, 404
DdeI CTNAG 5 cut(s) 16, 183, 320, 359, 422
DpnI GATC 2 cut(s) 78, 212
DpnII GATC 2 cut(s) 76, 210
Eco130I CCWWGG 1 cut(s) 39
EcoRII CCWGG 2 cut(s) 105, 233
EcoT14I CCWWGG 1 cut(s) 39
ErhI CCWWGG 1 cut(s) 39
FaeI CATG 1 cut(s) 217
FaiI YATR 2 cut(s) 32, 215
FalI AAGNNNNNCTT 2 cut(s) 342, 374
FatI CATG 1 cut(s) 213
FokI GGATG 2 cut(s) 251, 377
HaeIII GGCC 2 cut(s) 38, 357
HapII CCGG 1 cut(s) 395
Hin1II CATG 1 cut(s) 217
HpaII CCGG 1 cut(s) 395
Hpy188I TCNGA 1 cut(s) 176
HpyAV CCTTC 3 cut(s) 28, 281, 381
HpyCH4IV ACGT 2 cut(s) 21, 84
HpyCH4V TGCA 1 cut(s) 99
HpyF3I CTNAG 5 cut(s) 16, 183, 320, 359, 422
HpySE526I ACGT 2 cut(s) 21, 84
Hsp92II CATG 1 cut(s) 217
Kzo9I GATC 2 cut(s) 76, 210
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 7 cut(s) 92, 119, 162, 220, 247, 408, 409
MaeII ACGT 2 cut(s) 21, 84
MaeIII GTNAC 2 cut(s) 178, 190
MalI GATC 2 cut(s) 78, 212
MboI GATC 2 cut(s) 76, 210
MflI RGATCY 1 cut(s) 76
MnlI CCTC 2 cut(s) 15, 178
MseI TTAA 2 cut(s) 257, 348
MspI CCGG 1 cut(s) 395
MspR9I CCNGG 3 cut(s) 107, 235, 395
Mva1269I GAATGC 2 cut(s) 261, 423
MvaI CCWGG 2 cut(s) 107, 235
NciI CCSGG 1 cut(s) 395
NdeII GATC 2 cut(s) 76, 210
NlaIII CATG 1 cut(s) 217
NlaIV GGNNCC 2 cut(s) 13, 78
PctI GAATGC 2 cut(s) 261, 423
PfoI TCCNGGA 1 cut(s) 393
Psp6I CCWGG 2 cut(s) 105, 233
PspGI CCWGG 2 cut(s) 105, 233
PspN4I GGNNCC 2 cut(s) 13, 78
PsrI GAACNNNNNNTAC 2 cut(s) 317, 349
PsuI RGATCY 1 cut(s) 76
RsaI GTAC 2 cut(s) 318, 405
RsaNI GTAC 2 cut(s) 317, 404
SaqAI TTAA 2 cut(s) 257, 348
Sau3AI GATC 2 cut(s) 76, 210
ScrFI CCNGG 3 cut(s) 107, 235, 395
SetI ASST 5 cut(s) 17, 24, 87, 365, 428
SfcI CTRYAG 1 cut(s) 384
SmlI CTYRAG 2 cut(s) 6, 92
SmoI CTYRAG 2 cut(s) 6, 92
SsiI CCGC 1 cut(s) 228
StyD4I CCNGG 3 cut(s) 105, 233, 393
StyI CCWWGG 1 cut(s) 39
TaiI ACGT 2 cut(s) 24, 87
TatI WGTACW 1 cut(s) 316
Tru1I TTAA 2 cut(s) 257, 348
Tru9I TTAA 2 cut(s) 257, 348
TspDTI ATGAA 2 cut(s) 47, 320
TspGWI ACGGA 1 cut(s) 354
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.