Rroxscaffold_3G00257500

Elicitor-responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0015617
Physical Location & Seq
Forward (+)
51854579 .. 51855255
677 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00257500.1

Sequence Viewer

Length: 414 bp
ATGCCTCAAGGAACCTTAGACGTTCAACTTATGAAGGCCAAGGGTCTAAAAAACACAGAGTTCTTTGGTAAGATGGATCCTTACGTCATCCTCAAGTGCAAAAACCAGGAAAAAAGGAGCAAAGTGGCAACATCACAAGGTTCTAACCCAGAATGGAATGAGAAGTTTGTTTTCCGAGTAACTGAGGGTGTTACTGAACTCAAAATGACGATCATGGACAAGGACACTGCTACCAGGGATGATTTTGTAGGAGAGTTAAGCATTCCACTAAAAACACTATTCCAAGAAGGGAAACTCCCACCAATGAAATACAATGTACTAAGGAACAAAAAATACTACGGAGAGATTAAAGTTGGCCTTAGCTTCACTCCTTCAGTACGTGCTTGTTCTTTCCCATCTTCGATCAGTCGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C2

Protein Analysis

137

Amino Acids

15.58

Weight (kDa)

9.54

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
C2 PF00168 4 - 98 1.8e-25 C2 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015617)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g01841
malus_domestica MD14G1098100.v1.1
prunus_persica Prupe.5G094600_v2.0.a1
pyrus_communis pycom14g09620
rosa_chinensis RchiOBHm_Chr7g0198691
rosa_laevigata RLG00000003845
rosa_roxburghii Rroxscaffold_3G00257500
rosa_rugosa Rorug07G0049500 Rorug07G0049600 Rorug07G0049700 Rorug07G0049800
rosa_samantha Rh7AG173200 Rh7BG176600 Rh7CG182500 Rh7DG175900
rosa_wichuraiana Rw7G015170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 71, 84
AcuI CTGAAG 1 cut(s) 357
AfaI GTAC 2 cut(s) 318, 378
AgsI TTSAA 1 cut(s) 26
AjnI CCWGG 2 cut(s) 105, 233
AluBI AGCT 1 cut(s) 363
AluI AGCT 1 cut(s) 363
AlwI GGATC 2 cut(s) 71, 84
AoxI GGCC 2 cut(s) 36, 355
BamHI GGATCC 1 cut(s) 76
BccI CCATC 2 cut(s) 67, 403
BciT130I CCWGG 2 cut(s) 107, 235
Bme1390I CCNGG 2 cut(s) 107, 235
BmiI GGNNCC 2 cut(s) 13, 78
BmrFI CCNGG 2 cut(s) 107, 235
Bpu10I CCTNAGC 1 cut(s) 359
BpuEI CTTGAG 1 cut(s) 77
BsaAI YACGTR 1 cut(s) 380
BsaJI CCNNGG 2 cut(s) 39, 234
BseBI CCWGG 2 cut(s) 107, 235
BseDI CCNNGG 2 cut(s) 39, 234
BseGI GGATG 2 cut(s) 87, 244
BseMII CTCAG 1 cut(s) 174
BshFI GGCC 2 cut(s) 38, 357
BsmI GAATGC 1 cut(s) 261
BsnI GGCC 2 cut(s) 38, 357
Bsp143I GATC 3 cut(s) 76, 210, 402
BspANI GGCC 2 cut(s) 38, 357
BspCNI CTCAG 1 cut(s) 175
BspLI GGNNCC 2 cut(s) 13, 78
BspPI GGATC 2 cut(s) 71, 84
BssECI CCNNGG 2 cut(s) 39, 234
BssMI GATC 3 cut(s) 76, 210, 402
BssT1I CCWWGG 1 cut(s) 39
Bst2UI CCWGG 2 cut(s) 107, 235
BstBAI YACGTR 1 cut(s) 380
BstDEI CTNAG 4 cut(s) 16, 183, 320, 359
BstF5I GGATG 2 cut(s) 87, 244
BstKTI GATC 3 cut(s) 79, 213, 405
BstMBI GATC 3 cut(s) 76, 210, 402
BstNI CCWGG 2 cut(s) 107, 235
BstSCI CCNGG 2 cut(s) 105, 233
BstX2I RGATCY 1 cut(s) 76
BstYI RGATCY 1 cut(s) 76
BsuRI GGCC 2 cut(s) 38, 357
BtsCI GGATG 2 cut(s) 87, 244
BtsI GCAGTG 1 cut(s) 225
BtsIMutI CAGTG 1 cut(s) 225
Csp6I GTAC 2 cut(s) 317, 377
CviAII CATG 1 cut(s) 214
CviJI RGCY 3 cut(s) 38, 357, 363
CviKI_1 RGCY 3 cut(s) 38, 357, 363
CviQI GTAC 2 cut(s) 317, 377
DdeI CTNAG 4 cut(s) 16, 183, 320, 359
DpnI GATC 3 cut(s) 78, 212, 404
DpnII GATC 3 cut(s) 76, 210, 402
Eco130I CCWWGG 1 cut(s) 39
Eco57I CTGAAG 1 cut(s) 357
EcoRII CCWGG 2 cut(s) 105, 233
EcoT14I CCWWGG 1 cut(s) 39
ErhI CCWWGG 1 cut(s) 39
FaeI CATG 1 cut(s) 217
FaiI YATR 2 cut(s) 32, 215
FalI AAGNNNNNCTT 2 cut(s) 342, 374
FatI CATG 1 cut(s) 213
FokI GGATG 2 cut(s) 74, 251
HaeIII GGCC 2 cut(s) 38, 357
Hin1II CATG 1 cut(s) 217
Hpy188I TCNGA 1 cut(s) 176
HpyAV CCTTC 3 cut(s) 28, 281, 381
HpyCH4IV ACGT 3 cut(s) 21, 84, 379
HpyCH4V TGCA 1 cut(s) 99
HpyF3I CTNAG 4 cut(s) 16, 183, 320, 359
HpySE526I ACGT 3 cut(s) 21, 84, 379
Hsp92II CATG 1 cut(s) 217
Kzo9I GATC 3 cut(s) 76, 210, 402
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 5 cut(s) 92, 119, 162, 220, 247
MaeII ACGT 3 cut(s) 21, 84, 379
MaeIII GTNAC 2 cut(s) 178, 190
MalI GATC 3 cut(s) 78, 212, 404
MboI GATC 3 cut(s) 76, 210, 402
MboII GAAGA 1 cut(s) 390
MflI RGATCY 1 cut(s) 76
MnlI CCTC 3 cut(s) 15, 101, 178
MseI TTAA 3 cut(s) 257, 348, 412
MspR9I CCNGG 2 cut(s) 107, 235
Mva1269I GAATGC 1 cut(s) 261
MvaI CCWGG 2 cut(s) 107, 235
NdeII GATC 3 cut(s) 76, 210, 402
NlaIII CATG 1 cut(s) 217
NlaIV GGNNCC 2 cut(s) 13, 78
PctI GAATGC 1 cut(s) 261
Ppu21I YACGTR 1 cut(s) 380
Psp6I CCWGG 2 cut(s) 105, 233
PspGI CCWGG 2 cut(s) 105, 233
PspN4I GGNNCC 2 cut(s) 13, 78
PsrI GAACNNNNNNTAC 2 cut(s) 317, 349
PsuI RGATCY 1 cut(s) 76
RsaI GTAC 2 cut(s) 318, 378
RsaNI GTAC 2 cut(s) 317, 377
SaqAI TTAA 3 cut(s) 257, 348, 412
Sau3AI GATC 3 cut(s) 76, 210, 402
ScrFI CCNGG 2 cut(s) 107, 235
SetI ASST 6 cut(s) 17, 24, 87, 142, 365, 382
SmlI CTYRAG 2 cut(s) 6, 92
SmoI CTYRAG 2 cut(s) 6, 92
StyD4I CCNGG 2 cut(s) 105, 233
StyI CCWWGG 1 cut(s) 39
TaiI ACGT 3 cut(s) 24, 87, 382
TaqI TCGA 1 cut(s) 401
TatI WGTACW 1 cut(s) 316
Tru1I TTAA 3 cut(s) 257, 348, 412
Tru9I TTAA 3 cut(s) 257, 348, 412
TscAI CASTG 1 cut(s) 232
TspDTI ATGAA 2 cut(s) 47, 320
TspGWI ACGGA 1 cut(s) 354
TspRI CASTG 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.