RLG00000003845

Elicitor-responsive protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Forward (+)
53501417 .. 53502699
1283 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000003845

Sequence Viewer

Length: 429 bp
ATGCCTCAAGGAACCTTGGACGTTCAACTTATGAAGGCCAAGGGTCTAAAAAACACAGAGTTCTTTGGTAAGATGGATCCTTACGTCATCCTCAAGTGCAAAAACCAAGAGAAAAGGAGCAAAGTGGCAACATCACAAGGGTCTAACCCAGAATGGAATGAGAAGTTTGTTTTCCGAGTAACTGAGGGTGTGACTGAACTCAAAATGACGATCATGGACAAGGACACTGCTACCAGGGATGATTTTGTAGGAGAGTTAAGCATTCCACTAAAAACACTATTCCAAGAAGGGAAACTCCCACCAATGAAATACAATGTACTAAGGAACAAAAAATACTACGGAGAGATTAAAGTTGGCCTTAGCTTCACTCCTTCAGTACCCAGCAAAATATCCGAAGAATCCTTTGGCGGATGGAAAGAGTCTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

143

Amino Acids

16.12

Weight (kDa)

9.23

Isoelectric Point (pI)

40.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
C2 PF00168 4 - 98 2e-25 C2 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015617)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 408
AclWI GGATC 2 cut(s) 71, 84
AcuI CTGAAG 1 cut(s) 357
AfaI GTAC 2 cut(s) 318, 378
AgsI TTSAA 1 cut(s) 26
AjnI CCWGG 1 cut(s) 233
AjuI GAANNNNNNNTTGG 2 cut(s) 387, 419
AluBI AGCT 1 cut(s) 363
AluI AGCT 1 cut(s) 363
AlwI GGATC 2 cut(s) 71, 84
AoxI GGCC 2 cut(s) 36, 355
BamHI GGATCC 1 cut(s) 76
BbsI GAAGAC 1 cut(s) 414
BccI CCATC 2 cut(s) 67, 405
BciT130I CCWGG 1 cut(s) 235
Bme1390I CCNGG 1 cut(s) 235
BmiI GGNNCC 2 cut(s) 13, 78
BmrFI CCNGG 1 cut(s) 235
BpiI GAAGAC 1 cut(s) 414
Bpu10I CCTNAGC 1 cut(s) 359
BpuEI CTTGAG 1 cut(s) 77
BsaJI CCNNGG 3 cut(s) 15, 39, 234
BseBI CCWGG 1 cut(s) 235
BseDI CCNNGG 3 cut(s) 15, 39, 234
BseGI GGATG 3 cut(s) 87, 244, 416
BseMII CTCAG 1 cut(s) 174
BseYI CCCAGC 1 cut(s) 380
BshFI GGCC 2 cut(s) 38, 357
BsmI GAATGC 1 cut(s) 261
BsnI GGCC 2 cut(s) 38, 357
Bsp143I GATC 2 cut(s) 76, 210
BspACI CCGC 1 cut(s) 408
BspANI GGCC 2 cut(s) 38, 357
BspCNI CTCAG 1 cut(s) 175
BspLI GGNNCC 2 cut(s) 13, 78
BspPI GGATC 2 cut(s) 71, 84
BssECI CCNNGG 3 cut(s) 15, 39, 234
BssMI GATC 2 cut(s) 76, 210
BssT1I CCWWGG 2 cut(s) 15, 39
Bst2UI CCWGG 1 cut(s) 235
BstDEI CTNAG 3 cut(s) 183, 320, 359
BstF5I GGATG 3 cut(s) 87, 244, 416
BstKTI GATC 2 cut(s) 79, 213
BstMBI GATC 2 cut(s) 76, 210
BstNI CCWGG 1 cut(s) 235
BstSCI CCNGG 1 cut(s) 233
BstV2I GAAGAC 1 cut(s) 414
BstX2I RGATCY 1 cut(s) 76
BstYI RGATCY 1 cut(s) 76
BsuRI GGCC 2 cut(s) 38, 357
BtsCI GGATG 3 cut(s) 87, 244, 416
BtsI GCAGTG 1 cut(s) 225
BtsIMutI CAGTG 1 cut(s) 225
Csp6I GTAC 2 cut(s) 317, 377
CviAII CATG 1 cut(s) 214
CviJI RGCY 3 cut(s) 38, 357, 363
CviKI_1 RGCY 3 cut(s) 38, 357, 363
CviQI GTAC 2 cut(s) 317, 377
DdeI CTNAG 3 cut(s) 183, 320, 359
DpnI GATC 2 cut(s) 78, 212
DpnII GATC 2 cut(s) 76, 210
EciI GGCGGA 1 cut(s) 423
Eco130I CCWWGG 2 cut(s) 15, 39
Eco57I CTGAAG 1 cut(s) 357
EcoRII CCWGG 1 cut(s) 233
EcoT14I CCWWGG 2 cut(s) 15, 39
ErhI CCWWGG 2 cut(s) 15, 39
FaeI CATG 1 cut(s) 217
FaiI YATR 3 cut(s) 32, 215, 427
FalI AAGNNNNNCTT 2 cut(s) 342, 374
FatI CATG 1 cut(s) 213
FokI GGATG 3 cut(s) 74, 251, 423
GsaI CCCAGC 1 cut(s) 384
HaeIII GGCC 2 cut(s) 38, 357
Hin1II CATG 1 cut(s) 217
HinfI GANTC 2 cut(s) 398, 419
Hpy188I TCNGA 2 cut(s) 176, 394
HpyAV CCTTC 3 cut(s) 28, 281, 381
HpyCH4IV ACGT 2 cut(s) 21, 84
HpyCH4V TGCA 1 cut(s) 99
HpyF3I CTNAG 3 cut(s) 183, 320, 359
HpySE526I ACGT 2 cut(s) 21, 84
Hsp92II CATG 1 cut(s) 217
Kzo9I GATC 2 cut(s) 76, 210
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 4 cut(s) 162, 220, 247, 394
MaeII ACGT 2 cut(s) 21, 84
MaeIII GTNAC 2 cut(s) 178, 190
MalI GATC 2 cut(s) 78, 212
MboI GATC 2 cut(s) 76, 210
MboII GAAGA 2 cut(s) 407, 414
MflI RGATCY 1 cut(s) 76
MlyI GAGTC 1 cut(s) 428
MnlI CCTC 3 cut(s) 15, 101, 178
MseI TTAA 2 cut(s) 257, 348
MspR9I CCNGG 1 cut(s) 235
Mva1269I GAATGC 1 cut(s) 261
MvaI CCWGG 1 cut(s) 235
NdeII GATC 2 cut(s) 76, 210
NlaIII CATG 1 cut(s) 217
NlaIV GGNNCC 2 cut(s) 13, 78
NmuCI GTSAC 1 cut(s) 190
PctI GAATGC 1 cut(s) 261
PfeI GAWTC 1 cut(s) 398
PleI GAGTC 1 cut(s) 427
PpsI GAGTC 1 cut(s) 427
Psp6I CCWGG 1 cut(s) 233
PspFI CCCAGC 1 cut(s) 380
PspGI CCWGG 1 cut(s) 233
PspN4I GGNNCC 2 cut(s) 13, 78
PsrI GAACNNNNNNTAC 2 cut(s) 317, 349
PsuI RGATCY 1 cut(s) 76
RsaI GTAC 2 cut(s) 318, 378
RsaNI GTAC 2 cut(s) 317, 377
SaqAI TTAA 2 cut(s) 257, 348
Sau3AI GATC 2 cut(s) 76, 210
SchI GAGTC 1 cut(s) 428
ScrFI CCNGG 1 cut(s) 235
SetI ASST 4 cut(s) 17, 24, 87, 365
SmlI CTYRAG 2 cut(s) 6, 92
SmoI CTYRAG 2 cut(s) 6, 92
SsiI CCGC 1 cut(s) 408
StyD4I CCNGG 1 cut(s) 233
StyI CCWWGG 2 cut(s) 15, 39
TaiI ACGT 2 cut(s) 24, 87
TatI WGTACW 1 cut(s) 316
TfiI GAWTC 1 cut(s) 398
Tru1I TTAA 2 cut(s) 257, 348
Tru9I TTAA 2 cut(s) 257, 348
TscAI CASTG 1 cut(s) 232
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 3 cut(s) 47, 320, 414
TspGWI ACGGA 1 cut(s) 354
TspRI CASTG 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.